I'm new to python and this site so thank-you in advance for your... understanding. This is my first attempt at a python script.
I'm having what I think is a performance issue trying to solve this problem which is causing me to not get any data back.
This code works on a small text file of a couple pages but when I try to use it on my 35MB real data text file it just hits the CPU and hasn't returned any data (>24 hours now).
Here's a snippet of the real data from the 35MB text file:
D)dddld
d00d90d
dd
ddd
vsddfgsdfgsf
dfsdfdsf
aAAAAAa
221546
29806916295
Meowing
fs:/mod/umbapp/umb/sentbox/221546.pdu
2013:10:4:22:11:31:4
sadfsdfsdf
sdfff
ff
f
29806916295
What's your cat doing?
fs:/mod/umbapp/umb/sentbox/10955.pdu
2013:10:4:22:10:15:4
aaa
aaa
aaaaa
What I'm trying to copy into a new file:
29806916295
Meowing
fs:/mod/umbapp/umb/sentbox/221546.pdu
2013:10:4:22:11:31:4
29806916295
What's your cat doing?
fs:/mod/umbapp/umb/sentbox/10955.pdu
2013:10:4:22:10:15:4
My Python code is:
import re
with open('testdata.txt') as myfile:
content = myfile.read()
text = re.search(r'\d{11}.*\n.*\n.*(\d{4})\D+(\d{2})\D+(\d{1})\D+(\d{2})\D+(\d{2})\D+\d{2}\D+\d{1}', content, re.DOTALL).group()
with open("result.txt", "w") as myfile2:
myfile2.write(text)
Regex isn't the fastest way to search a string. You also compounded the problem by having a very big string (35MB). Reading an entire file into memory is generally not recommended because you may run into memory issues.
Judging from your regex pattern, it seems like you want to capture 4-line groups that start with an 11-digit string and end with some time-line string. Try this code:
import re
start_pattern = re.compile(r'^\d{11}$')
end_pattern = re.compile(r'^\d{4}\D+\d{2}\D+\d{1}\D+\d{2}\D+\d{2}\D+\d{2}\D+\d{1}$')
capturing = 0
capture = ''
with open('output.txt', 'w') as output_file:
with open('input.txt', 'r') as input_file:
for line in input_file:
if capturing > 0 and capturing <= 4:
capturing += 1
capture += line
elif start_pattern.match(line):
capturing = 1
capture = line
if capturing == 4:
if end_pattern.match(line):
output_file.write(capture + '\n')
else:
capturing = 0
It iterates over the input file, line by line. If it finds a line matching the start_pattern, it will read in 3 more. If the 4th line matches the end_pattern, it will write the whole group to the output file.
Related
I have two large files. One of them is an info file(about 270MB and 16,000,000 lines) like this:
1101:10003:17729
1101:10003:19979
1101:10003:23319
1101:10003:24972
1101:10003:2539
1101:10003:28242
1101:10003:28804
The other is a standard FASTQ format(about 27G and 280,000,000 lines) like this:
#ST-E00126:65:H3VJ2CCXX:7:1101:1416:1801 1:N:0:5
NTGCCTGACCGTACCGAGGCTAACCCTAATGAGCTTAATCAAGATGATGCTCGTTATGG
+
AAAFFKKKKKKKKKFKKKKKKKFKKKKAFKKKKKAF7AAFFKFAAFFFKKF7FF<FKK
#ST-E00126:65:H3VJ2CCXX:7:1101:10003:75641:N:0:5
TAAGATAGATAGCCGAGGCTAACCCTAATGAGCTTAATCAAGATGATGCTCGTTATGG
+
AAAFFKKKKKKKKKFKKKKKKKFKKKKAFKKKKKAF7AAFFKFAAFFFKKF7FF<FKK
The FASTQ file uses four lines per sequence. Line 1 begins with a '#' character and is followed by a sequence identifie. For each sequence,this part of the Line 1 is unique.
1101:1416:1801 and 1101:10003:75641
And I want to grab the Line 1 and the next three lines from the FASTQ file according to the info file. Here is my code:
import gzip
import re
count = 0
with open('info_path') as info, open('grab_path','w') as grab:
for i in info:
sample = i.strip()
with gzip.open('fq_path') as fq:
for j in fq:
count += 1
if count%4 == 1:
line = j.strip()
m = re.search(sample,j)
if m != None:
grab.writelines(line+'\n'+fq.next()+fq.next()+fq.next())
count = 0
break
And it works, but because both of these two files have millions of lines, it's inefficient(running one day only get 20,000 lines).
UPDATE at July 6th:
I find that the info file can be read into the memory(thank #tobias_k for reminding me), so I creat a dictionary that the keys are info lines and the values are all 0. After that, I read the FASTQ file every 4 line, use the identifier part as the key,if the value is 0 then return the 4 lines. Here is my code:
import gzip
dic = {}
with open('info_path') as info:
for i in info:
sample = i.strip()
dic[sample] = 0
with gzip.open('fq_path') as fq, open('grap_path',"w") as grab:
for j in fq:
if j[:10] == '#ST-E00126':
line = j.split(':')
match = line[4] +':'+line[5]+':'+line[6][:-2]
if dic.get(match) == 0:
grab.writelines(j+fq.next()+fq.next()+fq.next())
This way is much faster, it takes 20mins to get all the matched lines(about 64,000,000 lines). And I have thought about sorting the FASTQ file first by external sort. Splitting the file that can be read into the memory is ok, my trouble is how to keep the next three lines following the indentifier line while sorting. The Google's answer is to linear these four lines first, but it will take 40mins to do so.
Anyway thanks for your help.
You can sort both files by the identifier (the 1101:1416:1801) part. Even if files do not fit into memory, you can use external sorting.
After this, you can apply a simple merge-like strategy: read both files together and do the matching in the meantime. Something like this (pseudocode):
entry1 = readFromFile1()
entry2 = readFromFile2()
while (none of the files ended)
if (entry1.id == entry2.id)
record match
else if (entry1.id < entry2.id)
entry1 = readFromFile1()
else
entry2 = readFromFile2()
This way entry1.id and entry2.id are always close to each other and you will not miss any matches. At the same time, this approach requires iterating over each file once.
I am using printf command to log some values in a file as follows:
printf "Parameter = $parameter v9_value = $v9_val v9_line = $V9_Line_Count v16_val = $v16_val v16_line = $V16_Line_Count"
But the output I am getting as follows:
v16_line = 8elayServerPort v9_value = 41 v9_line = 8 v16_val = 4571
Seems like the line is printed in rotation manner, and last values are coming from starting.
Expected Output:
Parameter = RelayServerPort v9_value = 41 v9_line = 8 v16_val = 4571 v16_line = 8
But v16_line = 8 is overwritten on Parameter = R in line.
printf doesn't add a NL on the end. You need to add \n to the end of your printf.
Not seeing the rest of your program, or where you get your variable values, it's hard to say what else could be the issue.
One thing you can do is to redirect your output to a file and look at that file either through a good program editor or using cat -v which disables control characters.
See if you see ^M in your output. If you do, it could be that you have ^R in your variables.
Also remove $v16_val from your printf (temporarily) and see if your output looks better. If so, that $v16_val might have a CR (^M) in it.
I'm moving my bookmarks from kippt.com to pinboard.in.
I exported my bookmarks from Kippt and for some reason, they were storing tags (preceded by #) and description within the same field. Pinboard keeps tags and description separated.
This is what a Kippt bookmark looks like after export:
<DT>This is a title
<DD>#tag1 #tag2 This is a description
This is what it should look like before importing into Pinboard:
<DT>This is a title
<DD>This is a description
So basically, I need to replace #tag1 #tag2 by TAGS="tag1,tag2" and move it on the first line within <A>.
I've been reading about moving chunks of data here: sed or awk to move one chunk of text betwen first pattern pair into second pair?
I haven't been to come up with a good recipe so far. Any insight?
Edit:
Here's an actual example of what the input file looks like (3 entries out of 3500):
<DT>Phabricator
<DD>#bug #tracking
<DT>The hidden commands for diagnosing and improving your Netflix streaming quality – Quartz
<DT>Icelandic Farm Holidays | Local experts in Iceland vacations
<DD>#iceland #tour #car #drive #self Self-driving tour of Iceland
This might not be the most beautiful solution, but since it seems to be a one-time-thing it should be sufficient.
import re
dt = re.compile('^<DT>')
dd = re.compile('^<DD>')
with open('bookmarks.xml', 'r') as f:
for line in f:
if re.match(dt, line):
current_dt = line.strip()
elif re.match(dd, line):
current_dd = line
tags = [w for w in line[4:].split(' ') if w.startswith('#')]
current_dt = re.sub('(<A[^>]+)>', '\\1 TAGS="' + ','.join([t[1:] for t in tags]) + '">', current_dt)
for t in tags:
current_dd = current_dd.replace(t + ' ', '')
if current_dd.strip() == '<DD>':
current_dd = ""
else:
print current_dt
print current_dd
current_dt = ""
current_dd = ""
print current_dt
print current_dd
If some parts of the code are not clear, just tell me. You can of course use python to write the lines to a file instead of printing them, or even modify the original file.
Edit: Added if-clause so that empty <DD> lines won't show up in the result.
script.awk
BEGIN{FS="#"}
/^<DT>/{
if(d==1) print "<DT>"s # for printing lines with no tags
s=substr($0,5);tags="" # Copying the line after "<DT>". You'll know why
d=1
}
/^<DD>/{
d=0
m=match(s,/>/) # Find the end of the HREF descritor first match of ">"
for(i=2;i<=NF;i++){sub(/ $/,"",$i);tags=tags","$i} # Concatenate tags
td=match(tags,/ /) # Parse for tag description (marked by a preceding space).
if(td==0){ # No description exists
tags=substr(tags,2)
tagdes=""
}
else{ # Description exists
tagdes=substr(tags,td)
tags=substr(tags,2,td-2)
}
print "<DT>" substr(s,1,m-1) ", TAGS=\"" tags "\"" substr(s,m)
print "<DD>" tagdes
}
awk -f script.awk kippt > pinboard
INPUT
<DT>Phabricator
<DD>#bug #tracking
<DT>The hidden commands for diagnosing and improving your Netflix streaming quality – Quartz
<DT>Icelandic Farm Holidays | Local experts in Iceland vacations
<DD>#iceland #tour #car #drive #self Self-driving tour of Iceland
OUTPUT:
<DT>Phabricator
<DD>
<DT>The hidden commands for diagnosing and improving your Netflix streaming quality – Quartz
<DT>Icelandic Farm Holidays | Local experts in Iceland vacations
<DD> Self-driving tour of Iceland
I have written a python script that calls unix sort using subprocess module. I am trying to sort a table based on two columns(2 and 6). Here is what I have done
sort_bt=open("sort_blast.txt",'w+')
sort_file_cmd="sort -k2,2 -k6,6n {0}".format(tab.name)
subprocess.call(sort_file_cmd,stdout=sort_bt,shell=True)
The output file however contains an incomplete line which produces an error when I parse the table but when I checked the entry in the input file given to sort the line looks perfect. I guess there is some problem when sort tries to write the result to the file specified but I am not sure how to solve it though.
The line looks like this in the input file
gi|191252805|ref|NM_001128633.1| Homo sapiens RIMS binding protein 3C (RIMBP3C), mRNA gnl|BL_ORD_ID|4614 gi|124487059|ref|NP_001074857.1| RIMS-binding protein 2 [Mus musculus] 103 2877 3176 846 941 1.0102e-07 138.0
In output file however only gi|19125 is printed. How do I solve this?
Any help will be appreciated.
Ram
Using subprocess to call an external sorting tool seems quite silly considering that python has a built in method for sorting items.
Looking at your sample data, it appears to be structured data, with a | delimiter. Here's how you could open that file, and iterate over the results in python in a sorted manner:
def custom_sorter(first, second):
""" A Custom Sort function which compares items
based on the value in the 2nd and 6th columns. """
# First, we break the line into a list
first_items, second_items = first.split(u'|'), second.split(u'|') # Split on the pipe character.
if len(first_items) >= 6 and len(second_items) >= 6:
# We have enough items to compare
if (first_items[1], first_items[5]) > (second_items[1], second_items[5]):
return 1
elif (first_items[1], first_items[5]) < (second_items[1], second_items[5]):
return -1
else: # They are the same
return 0 # Order doesn't matter then
else:
return 0
with open(src_file_path, 'r') as src_file:
data = src_file.read() # Read in the src file all at once. Hope the file isn't too big!
with open(dst_sorted_file_path, 'w+') as dst_sorted_file:
for line in sorted(data.splitlines(), cmp = custom_sorter): # Sort the data on the fly
dst_sorted_file.write(line) # Write the line to the dst_file.
FYI, this code may need some jiggling. I didn't test it too well.
What you see is probably the result of trying to write to the file from multiple processes simultaneously.
To emulate: sort -k2,2 -k6,6n ${tabname} > sort_blast.txt command in Python:
from subprocess import check_call
with open("sort_blast.txt",'wb') as output_file:
check_call("sort -k2,2 -k6,6n".split() + [tab.name], stdout=output_file)
You can write it in pure Python e.g., for a small input file:
def custom_key(line):
fields = line.split() # split line on any whitespace
return fields[1], float(fields[5]) # Python uses zero-based indexing
with open(tab.name) as input_file, open("sort_blast.txt", 'w') as output_file:
L = input_file.read().splitlines() # read from the input file
L.sort(key=custom_key) # sort it
output_file.write("\n".join(L)) # write to the output file
If you need to sort a file that does not fit in memory; see Sorting text file by using Python
I'm trying to filter/append lines of hex data from a large log-file, using Ruby and RegEx.
The lines of the log-file that I need look like this:
Data: 10 55 61 (+ lots more hex data)
I want to add all of the hex data, for further processing later. The regex /^\sData:(.+)/ should do the trick.
My Ruby-program looks like this:
puts "Start"
fileIn = File.read("inputfile.txt")
fileOut = File.new("outputfile.txt", "w+")
fileOut.puts "Start of regex data\n"
fileIn.each_line do
dataLine = fileIn.match(/^\sData:(.+)/).captures
fileOut.write dataLine
end
fileOut.puts "\nEOF"
fileOut.close
puts "End"
It works - sort of - but the lines in the output file are all the same, just repeating the result of the first regex match.
What am I doing wrong?
You are iterating over the same entire file. You need to iterate over the line.
fileIn.each_line do |line|
dataLine = line.match(/^\sData:(.+)/).captures
fileOut.write dataLine
end