I have a file A and B .
A contains log entries
B contains some line numbers which in turn are some specific line numbers
referring the log file
I have an awk program like this:
echo "($(awk 'NR==1{r1=$1;next}
NR>2{printf"||"}
{printf"(NR>%d&&NR<%d)",r1,$1;r1=$1}' B))&&/mypattern/"|
awk -f- A
---> (courtesy jeff y from stack flow )
in this link you can find the requirement for which the above script is born
the part before the "|" generates the ranges to be search in file A.
eg : (NR>385&&NR<537)||(NR>537&&NR<539)||(NR>539&&NR<547)|
these are some of the ranges which can be generated by the part before "|"
I need to store the ranges for which "mypattern" has a match in a sep file ora variable ate last
say eg NR>385&&NR<537 --> this range on file A may not have a match according to my pattern where as (NR>539&&NR<547 this may have
so any idea to check whether a match had happened , if so to store the NR corresponding NR values in side a file .
Given your clarification in comments, I would propose a solution that only takes one pass through FILE_A with awk, rather than trying to extract and use line numbers and ranges numerically (FILE_B) in multiple passes:
awk '/Exception/ && !/ExceptionUnparseable date/ {
haveEx="yes"; ex=$0; exDate=last; haveMatch=""}
haveEx && /tms/ {
haveMatch="yes"; print exDate; print ex; haveEx=""}
haveMatch && /tms/ {print}
{last = $0} ' FILE_A
Or, if you don't need to see the lines that do match the pattern:
awk '/Exception/ && !/ExceptionUnparseable date/ {
haveEx="yes"; ex=$0; exDate=last}
haveEx && /tms/ {
print exDate; print ex; haveEx=""}
{last = $0} ' FILE_A
Related
I've been reading lots of helpful posts about reverse complementing sequences, but I've got what seems to be an unusual request. I'm working in bash and I have DNA sequences in fasta format in my stdout that I'd like to pass on down the pipe. The seemingly unusual bit is that I'm trying to reverse complement SOME of those sequences, so that the output has all the sequences in the same direction (for multiple sequence alignment later).
My fasta headers end in either "C" or "+". I'd like to reverse complement the ones that end in "C". Here's a little subset:
>chr1:86214203-86220231+
CTGGTGGTACAGCTACATTGTACCATAAAACTTATTCATATTAAAACTTA
TTTATATGTACCTCAAAAGATTAAACTGGGAGATAAGGTGTGGCATTTTT
>chr1:84518073-84524089C
caccttagagataatgaagtatattcagaatgtagaacattctataagac
aactgacccaatatcttttaaaaagtcaatgccatgttaaaaataaaaag
I know there are lots of ways to reverse complement out there, like:
echo ACCTTGAAA | tr ACGTacgt TGCAtgca | rev
and
seqtk seq -r in.fa > out.fa
But I'm not sure how to do this for only those sequences that have a C at the end of the header. I think awk or sed is probably the ticket, but I'm at a loss as to how to actually code it. I can get the sequence headers with awk, like:
awk '/^>/ { print $0 }'
>chr1:84518073-84524089C
>chr1:86214203-86220231+
But if someone could help me figure out how to turn that awk statement into one that asks "if the last character in the header has a C, do this!" that would be great!
Edited to add:
I was so tired when I made this post, I apologize for not including my desired output. Here is what I'd like to output to look like, using my little example:
>chr1:86214203-86220231+
CTGGTGGTACAGCTACATTGTACCATAAAACTTATTCATATTAAAACTTA
TTTATATGTACCTCAAAAGATTAAACTGGGAGATAAGGTGTGGCATTTTT
>chr1:84518073-84524089C
ctttttatttttaacatggcattgactttttaaaagatattgggtcagtt
gtcttatagaatgttctacattctgaatatacttcattatctctaaggtg
You can see the sequence that ends in + is unchanged, but the sequence with a header that ends in C is reverse complemented.
Thanks!
An earlier answer (by Ed Morton) uses a self-contained awk procedure to selectively reverse-complement sequences following a comment line ending with "C". Although I think that to be the best approach, I will offer an alternative approach that might have wider applicability.
The procedure here uses awk's system() function to send data extracted from the fasta file in awk to the shell where the sequence can be processed by any of the many shell applications existing for sequence manipulation.
I have defined an awk user function to pass the isolated sequence from awk to the shell. It can be called from any part of the awk procedure:
function processSeq(s)
{system("echo \"" s "\" | tr ACGTacgt TGCAtgca | rev ");}
The argument of the system function is a string containing the command you would type into terminal to achieve the desired outcome (in this case I've used one of the example reverse-complement routines mentioned in the question). The parts to note are the correct escaping of quote marks that are to appear in the shell command, and the variable s that will be substituted for the sequence string assigned to it when the function is called. The value of s is concatenated with the strings quoted before and after it in the argument to system() shown above.
isolating the required sequences
The rest of the procedure addresses how to achieve:
"if the last character in the header has a C, do this"
Before making use of shell applications, awk needs to isolate the part(s) of the file to process. In general terms, awk employs one or more pattern/action blocks where only records (lines by default) that match a given pattern are processed by the subsequent action commands. For example, the following illustrative procedure performs the action of printing the whole line print $0 if the pattern /^>/ && /C$/ is true for that line (where /^>/ looks for ">" at the start of a line and /C$/ looks for "C" at the end of the same line.:
/^>/ && /C$/{ print $0 }
For the current needs, the sequence begins on the next record (line) after any record beginning with > and ending with C. One way of referencing that next line is to set a variable (named line in my example) when the C line is encountered and establishing a later pattern for the record with numerical value one more than line variable.
Because fasta sequences may extend over several lines, we have to accumulate several successive lines following a C title line. I have achieved this by concatenating each line following the C title line until a record beginning with > is encountered again (or until the end of the file is reached, using the END block).
In order that sequence lines following a non-C title line are ignored, I have used a variable named flag with values of either "do" or "ignore" set when a title record is encountered.
The call to a the custom function processSeq() that employs the system() command, is made at the beginning of a C title action block if the variable seq holds an accumulated sequence (and in the END block for relevant sequences that occur at the end of the file where there will be no title line).
Test file and procedure
A modified version of your example fasta was used to test the procedure. It contains an extra relevant C record with three and-a-bit lines instead of two, and an extra irrelevant + record.
seq.fasta:
>chr1:86214203-86220231+
CTGGTGGTACAGCTACATTGTACCATAAAACTTATTCATATTAAAACTTA
TTTATATGTACCTCAAAAGATTAAACTGGGAGATAAGGTGTGGCATTTTT
>chr1:84518073-84524089C
caccttagagataatgaagtatattcagaatgtagaacattctataagac
aactgacccaatatcttttaaaaagtcaatgccatgttaaaaataaaaag
>chr1:86214203-86220231+
CTGGTGGTACAGCTACATTGTACCATAAAACTTATTCATATTAAAACTTA
TTTATATGTACCTCAAAAGATTAAACTGGGAGATAAGGTGTGGCATTTTT
>chranotherC
aatgaagtatattcagaatgtagaacattaactgacccgccatgttaatc
aatatctataagaccttttaaaaagcaccttagagattcaataaagtcag
gaagtatattcagaatgtagaacattaactgactaagaccttttaacatg
gcattgact
procedure
awk '
/^>/ && /C$/{
if (length(seq)>0) {processSeq(seq); seq="";}
line=NR; print $0; flag="do"; next;
}
/^>/ {line=NR; flag="ignore"}
NR>1 && NR==(line+1) && (flag=="do"){seq=seq $0; line=NR; next}
function processSeq(s)
{system("echo \"" s "\" | tr ACGTacgt TGCAtgca | rev ");}
END { if (length(seq)>0) processSeq(seq);}
' seq.fasta
output
>chr1:84518073-84524089C
ctttttatttttaacatggcattgactttttaaaagatattgggtcagttgtcttatagaatgttctacattctgaatatacttcattatctctaaggtg
>chranotherC
agtcaatgccatgttaaaaggtcttagtcagttaatgttctacattctgaatatacttcctgactttattgaatctctaaggtgctttttaaaaggtcttatagatattgattaacatggcgggtcagttaatgttctacattctgaatatacttcatt
Tested using GNU Awk 5.1.0 on a Raspberry Pi 400.
performance note
Because calling sytstem() creates a sub shell, this process will be slower than a self-contained awk procedure. It might be useful where existing shell routines are available or tricky to reproduce with custom awk routines.
Edit: modification to include unaltered + records
This version has some repetition of earlier blocks, with minor changes, to handle printing of the lines that are not to be reverse-complemented (the changes should be self-explanatory if the main explanations were understood)
awk '
/^>/ && /C$/{
if (length(seq)>0 && flag=="do") {processSeq(seq)} else {print seq} seq="";line=NR; print $0; flag="do"; next;
}
/^>/ {if (length(seq)>0 && flag=="do") {processSeq(seq)} else {print seq} seq=""; print $0; line=NR; flag="ignore"}
NR>1 && NR==(line+1){seq=seq $0; line=NR; next}
function processSeq(s)
{system("echo \"" s "\" | tr ACGTacgt TGCAtgca | rev ");}
END { if (length(seq)>0 && flag=="do") {processSeq(seq)} else {print seq}}
' seq.fasta
Using any awk:
$ cat tst.awk
/^>/ {
if ( NR > 1 ) {
prt()
}
head = $0
tail = ""
next
}
{ tail = ( tail == "" ? "" : tail ORS ) $0 }
END { prt() }
function prt( type) {
type = substr(head,length(head),1)
tail = ( type == "C" ? rev( tr( tail, "ACGTacgt TGCAtgca" ) ) : tail )
print head ORS tail
}
function tr(oldStr,trStr, i,lgth,char,newStr) {
if ( !_trSeen[trStr]++ ) {
lgth = (length(trStr) - 1) / 2
for ( i=1; i<=lgth; i++ ) {
_trMap[trStr,substr(trStr,i,1)] = substr(trStr,lgth+1+i,1)
}
}
lgth = length(oldStr)
for (i=1; i<=lgth; i++) {
char = substr(oldStr,i,1)
newStr = newStr ( (trStr,char) in _trMap ? _trMap[trStr,char] : char )
}
return newStr
}
function rev(oldStr, i,lgth,char,newStr) {
lgth = length(oldStr)
for ( i=1; i<=lgth; i++ ) {
char = substr(oldStr,i,1)
newStr = char newStr
}
return newStr
}
$ awk -f tst.awk file
>chr1:86214203-86220231+
CTGGTGGTACAGCTACATTGTACCATAAAACTTATTCATATTAAAACTTA
TTTATATGTACCTCAAAAGATTAAACTGGGAGATAAGGTGTGGCATTTTT
>chr1:84518073-84524089C
ctttttatttttaacatggcattgactttttaaaagatattgggtcagtt
gtcttatagaatgttctacattctgaatatacttcattatctctaaggtg
This might work for you (GNU sed):
sed -nE ':a;p;/^>.*C$/!b
:b;n;/^>/ba;s/^/\n/;y/ACGTacgt/TGCAtgca/
:c;tc;/\n$/{s///p;bb};s/(.*)\n(.)/\2\1\n/;tc' file
Print the current line and then inspect it.
If the line does not begin with > and end with C, bail out and repeat.
Otherwise, fetch the next line and if it begins with >, repeat the above line.
Otherwise, insert a newline (to use as a pivot point when reversing the line), complement the code of the line using a translation command. Then set about reversing the line, character by character until the inserted newline makes its way to the end of the line.
Remove the newline, print the result and repeat the line above.
N.B. The n command will terminate the script when it is executed after the last line has been read.
Since the OP has amended the ouput, another solution is when the whole of the sequence is complemented and then reversed. Here is another solution that I believe follows these criteria.
sed -nE ':a;p;/^>.*C$/!b
:b;n;/^>/!{H;$!bb};x;y/ACGTacgt\n/TGCAtgca%/;s/%/\n/
:c;tc;s/\n$//;td;s/(.*)\n(.)/\2\1\n/;tc
:d;y/%/\n/;p;z;x;$!ba' file
I have a file named list.txt containing a (supplier,product) pair and I must show the number of products from every supplier and their names using Linux terminal
Sample input:
stationery:paper
grocery:apples
grocery:pears
dairy:milk
stationery:pen
dairy:cheese
stationery:rubber
And the result should be something like:
stationery: 3
stationery: paper pen rubber
grocery: 2
grocery: apples pears
dairy: 2
dairy: milk cheese
Save the input to file, and remove the empty lines. Then use GNU datamash:
datamash -s -t ':' groupby 1 count 2 unique 2 < file
Output:
dairy:2:cheese,milk
grocery:2:apples,pears
stationery:3:paper,pen,rubber
The following pipeline shoud do the job
< your_input_file sort -t: -k1,1r | sort -t: -k1,1r | sed -E -n ':a;$p;N;s/([^:]*): *(.*)\n\1:/\1: \2 /;ta;P;D' | awk -F' ' '{ print $1, NF-1; print $0 }'
where
sort sorts the lines according to what's before the colon, in order to ease the successive processing
the cryptic sed joins the lines with common supplier
awk counts the items for supplier and prints everything appropriately.
Doing it with awk only, as suggested by KamilCuk in a comment, would be a much easier job; doing it with sed only would be (for me) a nightmare. Using both is maybe silly, but I enjoyed doing it.
If you need a detailed explanation, please comment, and I'll find time to provide one.
Here's the sed script written one command per line:
:a
$p
N
s/([^:]*): *(.*)\n\1:/\1: \2 /
ta
P
D
and here's how it works:
:a is just a label where we can jump back through a test or branch command;
$p is the print command applied only to the address $ (the last line); note that all other commands are applied to every line, since no address is specified;
N read one more line and appends it to the current pattern space, putting a \newline in between; this creates a multiline in the pattern space
s/([^:]*): *(.*)\n\1:/\1: \2 / captures what's before the first colon on the line, ([^:]*), as well as what follows it, (.*), getting rid of eccessive spaces, *;
ta tests if the previous s command was successful, and, if this is the case, transfers the control to the line labelled by a (i.e. go to step 1);
P prints the leading part of the multiline up to and including the embedded \newline;
D deletes the leading part of the multiline up to and including the embedded \newline.
This should be close to the only awk code I was referring to:
< os awk -F: '{ count[$1] += 1; items[$1] = items[$1] " " $2 } END { for (supp in items) print supp": " count[supp], "\n"supp":" items[supp]}'
The awk script is more readable if written on several lines:
awk -F: '{ # for each line
# we use the word before the : as the key of an associative array
count[$1] += 1 # increment the count for the given supplier
items[$1] = items[$1] " " $2 # concatenate the current item to the previous ones
}
END { # after processing the whole file
for (supp in items) # iterate on the suppliers and print the result
print supp": " count[supp], "\n"supp":" items[supp]
}
I've been trying to teach myself awk to accomplish the following, but haven't had much success.
I have a directory with several text files:
JV-01_S01_L007_R2_002_RepetitiveText_ToRemove.txt
JV-26_S48_L_RepetitiveText_ToRemove.txt
...
The structure of each text file is as follows. The numbers may change, but the accompanying text will always remain the same.
JV-01_S01_L007_R2_002_RepetitiveText_ToRemove.txt
4620178 reads; of these:
4620178 (100.00%) were unpaired; of these:
1226814 (26.55%) aligned 0 times
3040861 (65.82%) aligned exactly 1 time
352503 (7.63%) aligned >1 times
73.45% overall alignment rate
JV-26_S48_L_RepetitiveText_ToRemove.txt
1601831 reads; of these:
1601831 (100.00%) were unpaired; of these:
58800 (3.67%) aligned 0 times
1344724 (83.95%) aligned exactly 1 time
198307 (12.38%) aligned >1 times
96.33% overall alignment rate
For each file in this directory, I want to compile a csv with:
Sample Total_Reads Uniquely_Mapped_Reads Multi_Mapped_Reads Unmapped_Reads
JV-01_S01_L007_R2_002 4620178 3040861 352503 1226814
JV-26_S48_L 1601831 1344724 198307 58800
...
Is there any way to do this with a single for loop with awk? I was trying to use the match function.
For instance, if I could specify that match search within a specific line, and then search from left to right for a substring composed of any number of digits until a space is found. That would grab the substring of interest for that line.
Something along the lines of:
for file in *.txt
do
awk 'FNR == 1 {print FILENAME, match(NR==1, \d), match(NR==4, \d), match(NR==5, \d), match(NR==3, \d) } ' $file >> Names.csv
Here's an easy way, but it Requires GNU awk for multi-char RS.
You can read the file as a single record using the trick here. Then you just need to print out the fields you want (and this does depend on your assertion that the text is fixed)
$ awk -v RS="^$" '{print FILENAME, $1, $16, $22, $11}' jv-01 jv-26
jv-01 4620178 3040861 352503 1226814
jv-26 1601831 1344724 198307 58800
Could you please try following, written and tested with shown samples.
awk '
BEGIN{
print "Sample Total_Reads Uniquely_Mapped_Reads Multi_Mapped_Reads Unmapped_Reads"
}
FNR==1{
if(total_reads){
print file,total_reads,Uniquely_Mapped_Reads,times,Multi_Mapped_Reads,Unmapped_Reads
}
total_reads=Uniquely_Mapped_Reads=times=Multi_Mapped_Reads=Unmapped_Reads=""
sub(/_RepetitiveText.*/,"",FILENAME)
file=FILENAME
}
/reads; of these/{
total_reads=$1
next
}
/aligned exactly 1 time/{U
niquely_Mapped_Reads=$1
next
}
/aligned >1 times/{
Multi_Mapped_Reads=$1
next
}
/aligned [0-9]+ times/{
Unmapped_Reads=$1
}
END{
if(total_reads){
print file,total_reads,Uniquely_Mapped_Reads,times,Multi_Mapped_Reads,Unmapped_Reads
}
}
' *.txt | column -t
Given the following file structure,
9.975 1.49000000 0.295 0 0.4880 0.4929 0.5113 0.5245 2.016726 1.0472 -30.7449 1
9.975 1.49000000 0.295 1 0.4870 0.5056 0.5188 0.5045 2.015859 1.0442 -30.7653 1
9.975 1.50000000 0.295 0 0.5145 0.4984 0.4873 0.5019 2.002143 1.0854 -30.3044 2
is there a way to extract each line in which the value in column two is not equal to the value in column two in the following line?
I.e. from these three lines I would like to extract the second one, since 1.49 is not equal to 1.50.
Maybe with sed or awk?
This is how I do this in MATLAB:
myline = 1;
mynewline = 1;
while myline < length(myfile)
if myfile(myline,2) ~= myfile(myline+1,2)
mynewfile(mynewline,:) = myfile(myline,:);
mynewline = mynewline+1;
myline = myline+1;
else
myline = myline+1;
end
end
However, my files are so large now that I would prefer to carry out this extraction in terminal before transferring them to my laptop.
Awk should do.
<data awk '($2 != prev) {print line} {line = $0; prev = $2}'
A brief intro to awk: awk program consists of a set of condition {code} blocks. It operates line by line. When no condition is given, the block is executed for each line. BEGIN condition is executed before the first line. Each line is split to fields, which are accessible with $_number_. The full line is in $0.
Here I compare the second field to the previous value, if it does not match I print the whole previous line. In all cases I store the current line into line and the second field into prev.
And if you really want it right, careful with the float comparisons - something like abs($2 - prev) < eps (there is no abs in awk, you need to define it yourself, and eps is some small enough number). I'm actually not sure if awk converts to number for equality testing, if not you're safe with the string comparisons.
This might work for you (GNU sed):
sed -r 'N;/^((\S+)\s+){2}.*\n\S+\s+\2/!P;D' file
Read two lines at a time. Pattern match on the first two columns and only print the first line when the second column does not match.
Try following command:
awk '$2 != field && field { print line } { field = $2; line = $0 }' infile
It saves previous line and second field, comparing in next loop with current line values. The && field check is useful to avoid a blank line at the beginning of file, when $2 != field would match because variable is empty.
It yields:
9.975 1.49000000 0.295 1 0.4870 0.5056 0.5188 0.5045 2.015859 1.0442 -30.7653 1
I am having this example of ini file. I need to extract the names between 2 patterns Name_Z1 and OBJ=Name_Z1 and put them each on a line.
The problem is that there are more than one occurences with Name_Z1 and OBJ=Name_Z1 and i only need first occurence.
[Name_Z5]
random;text
Names;Jesus;Tom;Miguel
random;text
OBJ=Name_Z5
[Name_Z1]
random;text
Names;Jhon;Alex;Smith
random;text
OBJ=Name_Z1
[Name_Z2]
random;text
Names;Chris;Mara;Iordana
random;text
OBJ=Name_Z2
[Name_Z1_Phone]
random;text
Names;Bill;Stan;Mike
random;text
OBJ=Name_Z1_Phone
My desired output would be:
Jhon
Alex
Smith
I am currently writing a more ample script in bash and i am stuck on this. I prefer awk to do the job.
My greatly appreciation for who can help me. Thank you!
For Wintermute solution: The [Name_Z1] part looks like this:
[CAB_Z1]
READ_ONLY=false
FilterAttr=CeaseTime;blank|ObjectOfReference;contains;511047;512044;513008;593026;598326;CL5518;CL5521;CL5538;CL5612;CL5620|PerceivedSeverity;=;Critical;Major;Minor|ProbableCause;!=;HOUSE ALARM;IO DEVICE|ProblemText;contains;AIRE;ALIMENTA;BATER;CONVERTIDOR;DISTRIBUCION;FUEGO;HURTO;MAINS;MALLO;MAYOR;MENOR;PANEL;TEMP
NAME=CAB_Z1
And the [Name_Z1_Phone] part looks like this:
[CAB_Z1_FUEGO]
READ_ONLY=false
FilterAttr=CeaseTime;blank|ObjectOfReference;contains;511047;512044;513008;593026;598326;CL5518;CL5521;CL5538;CL5612;CL5620|PerceivedSeverity;=;Critical;Major;Minor|ProbableCause;!=;HOUSE ALARM;IO DEVICE|ProblemText;contains;FUEGO
NAME=CAB_Z1_FUEGO
The fix should be somewhere around the "|PerceivedSeverity"
Expected Output:
511047
512044
513008
593026
598326
CL5518
CL5521
CL5538
CL5612
CL5620
This should work:
sed -n '/^\[Name_Z1/,/^OBJ=Name_Z1/ { /^Names/ { s/^Names;//; s/;/\n/g; p; q } }' foo.txt
Explanation: Written readably, the code is
/^\[Name_Z1/,/^OBJ=Name_Z1/ {
/^Names/ {
s/^Names;//
s/;/\n/g
p
q
}
}
This means: In the pattern range /^\[Name_Z1/,/^OBJ=Name_Z1/, for all lines that match the pattern /^Names/, remove the Names; in the beginning, then replace all remaining ; with newlines, print the whole thing, and then quit. Since it immediately quits, it will only handle the first such line in the first such pattern range.
EDIT: The update made things a bit more complicated. I suggest
sed -n '/^\[CAB_Z1/,/^NAME=CAB_Z1/ { /^FilterAttr=/ { s/^.*contains;\(.*\)|PerceivedSeverity.*$/\1/; s/;/\n/g; p; q } }' foo.txt
The main difference is that instead of removing ^Names from a line, the substitution
s/^.*contains;\(.*\)|PerceivedSeverity.*$/\1/;
is applied. This isolates the part between contains; and |PerceivedSeverity before continuing as before. It assumes that there is only one such part in the line. If the match is ambiguous, it will pick the one that appears last in the line.
An (g)awk way that doesn't need a set number of fields(although i have assumed that contains; will always be on the line you need the names from.
(g)awk '(x+=/Z1/)&&match($0,/contains;([^|]+)/,a)&&gsub(";","\n",a[1]){print a[1];exit}' f
Explanation
(x+=/Z1/) - Increments x when Z1 is found. Also part of a
condition so x must exist to continue.
match($0,/contains;([^|]+)/,a) - Matches contains; and then captures everything after
up to the |. Stores the capture in a. Again a
condition so must succeed to continue.
gsub(";","\n",a[1]) - Substitutes all the ; for newlines in the capture
group a[1].
{print a[1];exit}' - If all conditions are met then print a[1] and exit.
This way should work in (m)awk
awk '(x+=/Z1/)&&/contains/{split($0,a,"|");y=split(a[2],b,";");for(i=3;i<=y;i++)
print b[i];exit}' file
sed -n '/\[Name_Z1\]/,/OBJ=Name_Z1$/ s/Names;//p' file.txt | tr ';' '\n'
That is sed -n to avoid printing anything not explicitly requested. Start from Name_Z1 and finish at OBJ=Name_Z1. Remove Names; and print the rest of the line where it occurs. Finally, replace semicolons with newlines.
Awk solution would be
$ awk -F";" '/Name_Z1/{f=1} f && /Names/{print $2,$3,$4} /OBJ=Name_Z1/{exit}' OFS="\n" input
Jhon
Alex
Smith
OR
$ awk -F";" '/Name_Z1/{f++} f==1 && /Names/{print $2,$3,$4}' OFS="\n" input
Jhon
Alex
Smith
-F";" sets the field seperator as ;
/Name_Z1/{f++} matches the line with pattern /Name_Z1/ If matched increment {f++}
f==1 && /Names/{print $2,$3,$4} is same as if f == 1 and maches pattern Name with line if true, then print the the columns 2 3 and 4 (delimted by ;)
OFS="\n" sets the output filed seperator as \n new line
EDIT
$ awk -F"[;|]" '/Z1/{f++} f==1 && NF>1{for (i=5; i<15; i++)print $i}' input
511047
512044
513008
593026
598326
CL5518
CL5521
CL5538
CL5612
CL5620
Here is a more generic solution for data in group of blocks.
This awk does not need the end tag, just the start.
awk -vRS= -F"\n" '/^\[Name_Z1\]/ {n=split($3,a,";");for (i=2;i<=n;i++) print a[i];exit}' file
Jhon
Alex
Smith
How it works:
awk -vRS= -F"\n" ' # By setting RS to nothing, one record equals one block. Then FS is set to one line as a field
/^\[Name_Z1\]/ { # Search for block with [Name_Z1]
n=split($3,a,";") # Split field 3, the names and store number of fields in variable n
for (i=2;i<=n;i++) # Loop from second to last field
print a[i] # Print the fields
exit # Exits after first find
' file
With updated data
cat file
data
[CAB_Z1_FUEGO]
READ_ONLY=false
FilterAttr=CeaseTime;blank|ObjectOfReference;contains;511047;512044;513008;593026;598326;CL5518;CL5521;CL5538;CL5612;CL5620|PerceivedSeverity;=;Critical;Major;Minor|ProbableCause;!=;HOUSE ALARM;IO DEVICE|ProblemText;contains;FUEGO
NAME=CAB_Z1_FUEGO
data
awk -vRS= -F"\n" '/^\[CAB_Z1_FUEGO\]/ {split($3,a,"|");n=split(a[2],b,";");for (i=3;i<=n;i++) print b[i]}' file
511047
512044
513008
593026
598326
CL5518
CL5521
CL5538
CL5612
CL5620
The following awk script will do what you want:
awk 's==1&&/^Names/{gsub("Names;","",$0);gsub(";","\n",$0);print}/^\[Name_Z1\]$/||/^OBJ=Name_Z1$/{s++}' inputFileName
In more detail:
s==1 && /^Names;/ {
gsub ("Names;","",$0);
gsub(";","\n",$0);
print
}
/^\[Name_Z1\]$/ || /^OBJ=Name_Z1$/ {
s++
}
The state s starts with a value of zero and is incremented whenever you find one of the two lines:
[Name_Z1]
OBJ=Name_Z1
That means, between the first set of those lines, s will be equal to one. That's where the other condition comes in. When s is one and you find a line starting with Names;, you do two substitutions.
The first is to get rid of the Names; at the front, the second is to replace all ; semi-colon characters with a newline. Then you print it out.
The output for your given test data is, as expected:
Jhon
Alex
Smith