Related
I have a .csv file that contains double quoted multi-line fields. I need to convert the multi-line cell to a single line. It doesn't show in the sample data but I do not know which fields might be multi-line so any solution will need to check every field. I do know how many columns I'll have. The first line will also need to be skipped. I don't how much data so performance isn't a consideration.
I need something that I can run from a bash script on Linux. Preferably using tools such as awk or sed and not actual programming languages.
The data will be processed further with Logstash but it doesn't handle double quoted multi-line fields hence the need to do some pre-processing.
I tried something like this and it kind of works on one row but fails on multiple rows.
sed -e :0 -e '/,.*,.*,.*,.*,/b' -e N -e '1n;N;N;N;s/\n/ /g' -e b0 file.csv
CSV example
First name,Last name,Address,ZIP
John,Doe,"Country
City
Street",12345
The output I want is
First name,Last name,Address,ZIP
John,Doe,Country City Street,12345
Jane,Doe,Country City Street,67890
etc.
etc.
First my apologies for getting here 7 months late...
I came across a problem similar to yours today, with multiple fields with multi-line types. I was glad to find your question but at least for my case I have the complexity that, as more than one field is conflicting, quotes might open, close and open again on the same line... anyway, reading a lot and combining answers from different posts I came up with something like this:
First I count the quotes in a line, to do that, I take out everything but quotes and then use wc:
quotes=`echo $line | tr -cd '"' | wc -c` # Counts the quotes
If you think of a single multi-line field, knowing if the quotes are 1 or 2 is enough. In a more generic scenario like mine I have to know if the number of quotes is odd or even to know if the line completes the record or expects more information.
To check for even or odd you can use the mod operand (%), in general:
even % 2 = 0
odd % 2 = 1
For the first line:
Odd means that the line expects more information on the next line.
Even means the line is complete.
For the subsequent lines, I have to know the status of the previous one. for instance in your sample text:
First name,Last name,Address,ZIP
John,Doe,"Country
City
Street",12345
You can say line 1 (John,Doe,"Country) has 1 quote (odd) what means the status of the record is incomplete or open.
When you go to line 2, there is no quote (even). Nevertheless this does not mean the record is complete, you have to consider the previous status... so for the lines following the first one it will be:
Odd means that record status toggles (incomplete to complete).
Even means that record status remains as the previous line.
What I did was looping line by line while carrying the status of the last line to the next one:
incomplete=0
cat file.csv | while read line; do
quotes=`echo $line | tr -cd '"' | wc -c` # Counts the quotes
incomplete=$((($quotes+$incomplete)%2)) # Check if Odd or Even to decide status
if [ $incomplete -eq 1 ]; then
echo -n "$line " >> new.csv # If line is incomplete join with next
else
echo "$line" >> new.csv # If line completes the record finish
fi
done
Once this was executed, a file in your format generates a new.csv like this:
First name,Last name,Address,ZIP
John,Doe,"Country City Street",12345
I like one-liners as much as everyone, I wrote that script just for the sake of clarity, you can - arguably - write it in one line like:
i=0;cat file.csv|while read l;do i=$((($(echo $l|tr -cd '"'|wc -c)+$i)%2));[[ $i = 1 ]] && echo -n "$l " || echo "$l";done >new.csv
I would appreciate it if you could go back to your example and see if this works for your case (which you most likely already solved). Hopefully this can still help someone else down the road...
Recovering the multi-line fields
Every need is different, in my case I wanted the records in one line to further process the csv to add some bash-extracted data, but I would like to keep the csv as it was. To accomplish that, instead of joining the lines with a space I used a code - likely unique - that I could then search and replace:
i=0;cat file.csv|while read l;do i=$((($(echo $l|tr -cd '"'|wc -c)+$i)%2));[[ $i = 1 ]] && echo -n "$l ~newline~ " || echo "$l";done >new.csv
the code is ~newline~, this is totally arbitrary of course.
Then, after doing my processing, I took the csv text file and replaced the coded newlines with real newlines:
sed -i 's/ ~newline~ /\n/g' new.csv
References:
Ternary operator: https://stackoverflow.com/a/3953666/6316852
Count char occurrences: https://stackoverflow.com/a/41119233/6316852
Other peculiar cases: https://www.linuxquestions.org/questions/programming-9/complex-bash-string-substitution-of-csv-file-with-multiline-data-937179/
TL;DR
Run this:
i=0;cat file.csv|while read l;do i=$((($(echo $l|tr -cd '"'|wc -c)+$i)%2));[[ $i = 1 ]] && echo -n "$l " || echo "$l";done >new.csv
... and collect results in new.csv
I hope it helps!
If Perl is your option, please try the following:
perl -e '
while (<>) {
$str .= $_;
}
while ($str =~ /("(("")|[^"])*")|((^|(?<=,))[^,]*((?=,)|$))/g) {
if (($el = $&) =~ /^".*"$/s) {
$el =~ s/^"//s; $el =~ s/"$//s;
$el =~ s/""/"/g;
$el =~ s/\s+(?!$)/ /g;
}
push(#ary, $el);
}
foreach (#ary) {
print /\n$/ ? "$_" : "$_,";
}' sample.csv
sample.csv:
First name,Last name,Address,ZIP
John,Doe,"Country
City
Street",12345
John,Doe,"Country
City
Street",67890
Result:
First name,Last name,Address,ZIP
John,Doe,Country City Street,12345
John,Doe,Country City Street,67890
This might work for you (GNU sed):
sed ':a;s/[^,]\+/&/4;tb;N;ba;:b;s/\n\+/ /g;s/"//g' file
Test each line to see that it contains the correct number of fields (in the example that was 4). If there are not enough fields, append the next line and repeat the test. Otherwise, replace the newline(s) by spaces and finally remove the "'s.
N.B. This may be fraught with problems such as ,'s between "'s and quoted "'s.
Try cat -v file.csv. When the file was made with Excel, you might have some luck: When the newlines in a field are a simple \n and the newline at the end is a \r\n (which will look like ^M), parsing is simple.
# delete all newlines and replace the ^M with a new newline.
tr -d "\n" < file.csv| tr "\r" "\n"
# Above two steps with one command
tr "\n\r" " \n" < file.csv
When you want a space between the joined line, you need an additional step.
tr "\n\r" " \n" < file.csv | sed '2,$ s/^ //'
EDIT: #sjaak commented this didn't work is his case.
When your broken lines also have ^M you still can be a lucky (wo-)man.
When your broken field is always the first field in double quotes and you have GNU sed 4.2.2, you can join 2 lines when the first line has exactly one double quote.
sed -rz ':a;s/(\n|^)([^"]*)"([^"]*)\n/\1\2"\3 /;ta' file.csv
Explanation:
-z don't use \n as line endings
:a label for repeating the step after successful replacement
(\n|^) Search after a newline or the very first line
([^"]*) Substring without a "
ta Go back to label a and repeat
awk pattern matching is working.
answer in one line :
awk '/,"/{ORS=" "};/",/{ORS="\n"}{print $0}' YourFile
if you'd like to drop quotes, you could use:
awk '/,"/{ORS=" "};/",/{ORS="\n"}{print $0}' YourFile | sed 's/"//gw NewFile'
but I prefer to keep it.
to explain the code:
/Pattern/ : find pattern in current line.
ORS : indicates the output line record.
$0 : indicates the whole of the current line.
's/OldPattern/NewPattern/': substitude first OldPattern with NewPattern
/g : does the previous action for all OldPattern
/w : write the result to Newfile
I am working with a fasta file and need to add line-specific text to each of the headers. So for example if my file is:
>TER1
AGCATGCTAGCTAGTCGACTCGATCGCATGCTC
>TER2
AGCATGCTAGCTAGACGACTCGATCGCATGCTC
>URC1
AGCATGCTAGCTAGTCGACTCGATCGCATGCTC
>URC2
AGCATGCTACCTAGTCGACTCGATCGCATGCTC
>UCR3
AGCATGCTAGCTAGTCGACTCGATGGCATGCTC
I want a while loop that will read through each line; for those with a > at the start, I want to append |population: plus the first three characters after the >. So line one would be:
>TER1|population:TER
etc.
I can't figure out how to make this work. Here my best attempt so far.
filename="testfasta.fa"
while read -r line
do
if [[ "$line" == ">"* ]]; then
id=$(cut -c2-4<<<"$line")
printf $line"|population:"$id"\n" >>outfile
else
printf $line"\n">>outfile
fi
done <"$filename"
This produces a file with the original headers and following line each on a single line.
Can someone tell me where I'm going wrong? My if and else loop aren't working at all!
Thanks!
You could use a while loop if you really want,
but sed would be simpler:
sed -e 's/^>\(...\).*/&|population:\1/' "$filename"
That is, for lines starting with > (pattern: ^>),
capture the next 3 characters (with \(...\)),
and match the rest of the line (.*),
replace with the line as it was (&),
and the fixed string |population:,
and finally the captured 3 characters (\1).
This will produce for your input:
>TER1|population:TER
AGCATGCTAGCTAGTCGACTCGATCGCATGCTC
>TER2|population:TER
AGCATGCTAGCTAGACGACTCGATCGCATGCTC
>URC1|population:URC
AGCATGCTAGCTAGTCGACTCGATCGCATGCTC
>URC2|population:URC
AGCATGCTACCTAGTCGACTCGATCGCATGCTC
>UCR3|population:UCR
AGCATGCTAGCTAGTCGACTCGATGGCATGCTC
Or you can use this awk, also producing the same output:
awk '{sub(/^>.*/, $0 "|population:" substr($0, 2, 3))}1' "$filename"
You can do this quickly in awk:
awk '$1~/^>/{$1=$1"|population:"substr($1,2,3)}{}1' infile.txt > outfile.txt
$ awk '$1~/^>/{$1=$1"|population:"substr($1,2,3)}{}1' testfile
>TER1|population:TER
AGCATGCTAGCTAGTCGACTCGATCGCATGCTC
>TER2|population:TER
AGCATGCTAGCTAGACGACTCGATCGCATGCTC
>URC1|population:URC
AGCATGCTAGCTAGTCGACTCGATCGCATGCTC
>URC2|population:URC
AGCATGCTACCTAGTCGACTCGATCGCATGCTC
>UCR3|population:UCR
AGCATGCTAGCTAGTCGACTCGATGGCATGCTC
Here awk will:
Test if the record starts with a > The $1 looks at the first field, but $0 for the entire record would work just as well in this case. The ~ will perform a regex test, and ^> means "Starts with >". Making the test: ($1~/^>/)
If so it will set the first field to the output you are looking for (using substr() to get the bits of the string you want. {$1=$1"|population:"substr($1,2,3)}
Finally it will print out the entire record (with the changes if applicable): {}1 which is shorthand for {print $0} or.. print the entire record.
I have a bunch of different kinds of files I need to look at periodically, and what they have in common is that the lines have a bunch of key=value type strings. So something like:
Version=2 Len=17 Hello Var=Howdy Other
I would like to be able to reference the names directly from awk... so something like:
cat some_file | ... | awk '{print Var, $5}' # prints Howdy Other
How can I go about doing that?
The closest you can get is to parse the variables into an associative array first thing every line. That is to say,
awk '{ delete vars; for(i = 1; i <= NF; ++i) { n = index($i, "="); if(n) { vars[substr($i, 1, n - 1)] = substr($i, n + 1) } } Var = vars["Var"] } { print Var, $5 }'
More readably:
{
delete vars; # clean up previous variable values
for(i = 1; i <= NF; ++i) { # walk through fields
n = index($i, "="); # search for =
if(n) { # if there is one:
# remember value by name. The reason I use
# substr over split is the possibility of
# something like Var=foo=bar=baz (that will
# be parsed into a variable Var with the
# value "foo=bar=baz" this way).
vars[substr($i, 1, n - 1)] = substr($i, n + 1)
}
}
# if you know precisely what variable names you expect to get, you can
# assign to them here:
Var = vars["Var"]
Version = vars["Version"]
Len = vars["Len"]
}
{
print Var, $5 # then use them in the rest of the code
}
$ cat file | sed -r 's/[[:alnum:]]+=/\n&/g' | awk -F= '$1=="Var"{print $2}'
Howdy Other
Or, avoiding the useless use of cat:
$ sed -r 's/[[:alnum:]]+=/\n&/g' file | awk -F= '$1=="Var"{print $2}'
Howdy Other
How it works
sed -r 's/[[:alnum:]]+=/\n&/g'
This places each key,value pair on its own line.
awk -F= '$1=="Var"{print $2}'
This reads the key-value pairs. Since the field separator is chosen to be =, the key ends up as field 1 and the value as field 2. Thus, we just look for lines whose first field is Var and print the corresponding value.
Since discussion in commentary has made it clear that a pure-bash solution would also be acceptable:
#!/bin/bash
case $BASH_VERSION in
''|[0-3].*) echo "ERROR: Bash 4.0 required" >&2; exit 1;;
esac
while read -r -a words; do # iterate over lines of input
declare -A vars=( ) # refresh variables for each line
set -- "${words[#]}" # update positional parameters
for word; do
if [[ $word = *"="* ]]; then # if a word contains an "="...
vars[${word%%=*}]=${word#*=} # ...then set it as an associative-array key
fi
done
echo "${vars[Var]} $5" # Here, we use content read from that line.
done <<<"Version=2 Len=17 Hello Var=Howdy Other"
The <<<"Input Here" could also be <file.txt, in which case lines in the file would be iterated over.
If you wanted to use $Var instead of ${vars[Var]}, then substitute printf -v "${word%%=*}" %s "${word*=}" in place of vars[${word%%=*}]=${word#*=}, and remove references to vars elsewhere. Note that this doesn't allow for a good way to clean up variables between lines of input, as the associative-array approach does.
I will try to explain you a very generic way to do this which you can adapt easily if you want to print out other stuff.
Assume you have a string which has a format like this:
key1=value1 key2=value2 key3=value3
or more generic
key1_fs2_value1_fs1_key2_fs2_value2_fs1_key3_fs2_value3
With fs1 and fs2 two different field separators.
You would like to make a selection or some operations with these values. To do this, the easiest is to store these in an associative array:
array["key1"] => value1
array["key2"] => value2
array["key3"] => value3
array["key1","full"] => "key1=value1"
array["key2","full"] => "key2=value2"
array["key3","full"] => "key3=value3"
This can be done with the following function in awk:
function str2map(str,fs1,fs2,map, n,tmp) {
n=split(str,map,fs1)
for (;n>0;n--) {
split(map[n],tmp,fs2);
map[tmp[1]]=tmp[2]; map[tmp[1],"full"]=map[n]
delete map[n]
}
}
So, after processing the string, you have the full flexibility to do operations in any way you like:
awk '
function str2map(str,fs1,fs2,map, n,tmp) {
n=split(str,map,fs1)
for (;n>0;n--) {
split(map[n],tmp,fs2);
map[tmp[1]]=tmp[2]; map[tmp[1],"full"]=map[n]
delete map[n]
}
}
{ str2map($0," ","=",map) }
{ print map["Var","full"] }
' file
The advantage of this method is that you can easily adapt your code to print any other key you are interested in, or even make selections based on this, example:
(map["Version"] < 3) { print map["var"]/map["Len"] }
The simplest and easiest way is to use the string substitution like this:
property='my.password.is=1234567890=='
name=${property%%=*}
value=${property#*=}
echo "'$name' : '$value'"
The output is:
'my.password.is' : '1234567890=='
Yore.
Using bash's set command, we can split the line into positional parameters like awk.
For each word, we'll try to read a name value pair delimited by =.
When we find a value, assign it to the variable named $key using bash's printf -v feature.
#!/usr/bin/env bash
line='Version=2 Len=17 Hello Var=Howdy Other'
set $line
for word in "$#"; do
IFS='=' read -r key val <<< "$word"
test -n "$val" && printf -v "$key" "$val"
done
echo "$Var $5"
output
Howdy Other
SYNOPSIS
an awk-based solution that doesn't require manually checking the fields to locate the desired key pair :
approach being avoid splitting unnecessary fields or arrays - only performing regex match via function call when needed
only returning FIRST occurrence of input key value. Subsequent matches along the row are NOT returned
i just called it S() cuz it's the closest letter to $
I only included an array (_) of the 3 test values for demo purposes. Those aren't needed. In fact, no state information is being kept at all
caveat being : key-match must be exact - this version of the code isn't for case-insensitive or fuzzy/agile matching
Tested and confirmed working on
- gawk 5.1.1
- mawk 1.3.4
- mawk-2/1.9.9.6
- macos nawk
CODE
# gawk profile, created Fri May 27 02:07:53 2022
{m,n,g}awk '
function S(__,_) {
return \
! match($(_=_<_), "(^|["(_="[:blank:]]")")"(__)"[=][^"(_)"*") \
? "^$" \
: substr(__=substr($-_, RSTART, RLENGTH), index(__,"=")+_^!_)
}
BEGIN { OFS = "\f" # This array is only for testing
_["Version"] _["Len"] _["Var"] # purposes. Feel free to discard at will
} {
for (__ in _) {
print __, S(__) } }'
OUTPUT
Var
Howdy
Len
17
Version
2
So either call the fields in BAU fashion
- $5, $0, $NF, etc
or call S(QUOTED_KEY_VALUE), case-sensitive, like
As a safeguard, to prevent mis-interpreting null strings
or invalid inputs as $0, a non-match returns ^$
instead of empty string
S("Version") to get back 2.
As a bonus, it can safely handle values in multibyte unicode, both for values and even for keys, regardless of whether ur awk is UTF-8-aware or not :
1 ✜
🤡
2 Version
2
3 Var
Howdy
4 Len
17
5 ✜=🤡 Version=2 Len=17 Hello Var=Howdy Other
I know this is particularly regarding awk but mentioning this as many people come here for solutions to break down name = value pairs ( with / without using awk as such).
I found below way simple straight forward and very effective in managing multiple spaces / commas as well -
Source: http://jayconrod.com/posts/35/parsing-keyvalue-pairs-in-bash
change="foo=red bar=green baz=blue"
#use below if var is in CSV (instead of space as delim)
change=`echo $change | tr ',' ' '`
for change in $changes; do
set -- `echo $change | tr '=' ' '`
echo "variable name == $1 and variable value == $2"
#can assign value to a variable like below
eval my_var_$1=$2;
done
So I have a file that contains some lines of text separated by ','. I want to create a script that counts how much parts a line has and if the line contains 16 parts i want to add a new one. So far its working great. The only thing that is not working is appending the ',' at the end. See my example below:
Original file:
a,a,a,a,a,a,a,a,a,a,a,a,a,a,a,a
b,b,b,b,b,b
a,a,a,a,a,a,a,a,a,a,a,a,a,a,a,a,a
b,b,b,b,b,b
a,a,a,a,a,a,a,a,a,a,a,a,a,a,a,a
Expected result:
a,a,a,a,a,a,a,a,a,a,a,a,a,a,a,a,xx
b,b,b,b,b,b
a,a,a,a,a,a,a,a,a,a,a,a,a,a,a,a,a
b,b,b,b,b,b
a,a,a,a,a,a,a,a,a,a,a,a,a,a,a,a,xx
This is my code:
while read p; do
if [[ $p == "HEA"* ]]
then
IFS=',' read -ra ADDR <<< "$p"
echo ${#ADDR[#]}
arrayCount=${#ADDR[#]}
if [ "${arrayCount}" -eq 16 ];
then
sed -i "/$p/ s/\$/,xx/g" $f
fi
fi
done <$f
Result:
a,a,a,a,a,a,a,a,a,a,a,a,a,a,a,a
,xx
b,b,b,b,b,b
a,a,a,a,a,a,a,a,a,a,a,a,a,a,a,a,a
b,b,b,b,b,b
a,a,a,a,a,a,a,a,a,a,a,a,a,a,a,a
,xx
What im doing wrong? I'm sure its something small but i cant find it..
It can be done using awk:
awk -F, 'NF==16{$0 = $0 FS "xx"} 1' file
a,a,a,a,a,a,a,a,a,a,a,a,a,a,a,a,xx
b,b,b,b,b,b
a,a,a,a,a,a,a,a,a,a,a,a,a,a,a,a,a
b,b,b,b,b,b
a,a,a,a,a,a,a,a,a,a,a,a,a,a,a,a,xx
-F, sets input field separator as comma
NF==16 is the condition that says execute block inside { and } if # of fields is 16
$0 = $0 FS "xx" appends xx at end of line
1 is the default awk action that means print the output
For using sed answer should be in the following:
Use ${line_number} s/..../..../ format - to target a specific line, you need to find out the line number first.
Use the special char & to denote the matched string
The sed statement should look like the following:
sed -i "${line_number}s/.*/&xx/"
I would prefer to leave it to you to play around with it but if you would prefer i can give you a full working sample.
I want to read lines from a text file and save them in a variable.
cat ${1} | while read name; do
namelist=${name_list},${name}
done
the file looks like this:
David
Kevin
Steve
etc.
and i want to get this output instead
David, Kevin, Steve etc.
and save it to the variable ${name_list}
The command:
$ tr -s '\n ' ',' < sourcefile.txt # Replace newlines and spaces with [,]
This will likely return a , as the last character (and potentially the first).
To shave of the comma(s) and return a satisfying result:
$ name_list=$(tr -s '\n ' ',' < sourcefile.txt) # store the previous result
$ name_list=${tmp%,} # shave off the last comma
$ name_list=${tmp#,} # shave off any first comma
EDIT
This solution runs 44% faster and yields consistent and valid results across all Unix platforms.
# This solution
python -mtimeit -s 'import subprocess' "subprocess.call('tmp=$(tr -s "\n " "," < input.txt);echo ${tmp%,} >/dev/null',shell = True)"
100 loops, best of 3: 3.71 msec per loop
# Highest voted:
python -mtimeit -s 'import subprocess' "subprocess.call('column input.txt | sed "s/\t/,/g" >/dev/null',shell = True)"
100 loops, best of 3: 6.69 msec per loop
name_list=""
for name in `cat file.txt`
do VAR="$name_list,$i"
done
EDIT: this script leaves a "," at the beginning of name_list. There are a number of ways to fix this. For example, in bash this should work:
name_list=""
for name in `cat file.txt`; do
if [[ -z $name_list ]]; then
name_list="$i"
else
name_list="$name_list,$i"
fi
done
RE-EDIT: so, thanks to the legitimate complaints of Fredrik:
name_list=""
while read name
do
if [[ -z $name_list ]]; then
name_list="$name"
else
name_list="$name_list,$name"
fi
done < file.txt
Using column, and sed:
namelist=$(column input | sed 's/\t/,/g')
variable=`perl -lne 'next if(/^\s*$/);if($a){$a.=",$_"}else{$a=$_};END{print $a}' your_file`