Given an integer, I need to find a match from a small set. The integer will almost always not be in the set. For most search algorithms, that is the worst case (taking the longest). But for this application, search time will be dominated by how quickly the search fails. So I want an algorithm who's best case is 'not found'.
Does such a thing exist?
The integers are far from random, being array indexes -- say 0..10k (15-bits). The sets will contain 0..7 integers, which is few enough for a simple linear search. But that would be worst case in almost every case.
The only thing I can think of would be a Bloom Filter. It would work something like this: Define F(int) = Set Bit (i AND 1Fh) (that is, a 32-bit integer with one bit set). With each set I would store the OR'd together values of F(each element) (a 32-bit integer with max n-bits set for n elements). The search would then be IF (F(i) AND F(set))>0 then perform linear search.
Thus the search would never be performed unless at least one set element had the same low 5-bits as the test integer i. A second test could be added based on the next lowest 5-bits.
Better ideas anyone?
The fastest algorithm I can imagine, which would succeed or fail immediately, is a huge array 0..MaxInt of Boolean, all False except True at Array[Set Member]. Search would be a simple array lookup:
Found = Array[Test]
But the memory footprint is absurd. A common optimization is a Hash Array.
As a test, I have implemented a Perfect Hash using bits of the Set Members. The function PHash(int) returns an integer 0..15 which is the array index where the match will be found if one exists. The search is then:
IF Array[PHash(Test)] = Test
THEN Found at Index PHash(Test)
ELSE Not Found
It will probably surprise no one that profiling shows this to be slower than a linear search.
(sigh)
Of course, no single Hash can reduce 15-bit integers to distinct 4-bit integers. I use many different hash functions. To produce the Set, I find which function produces distinct 4-bit hashes for that Set, then store the Set as the Hash Function Pointer plus a 16 element Array. Each Array element is either X or one Set Member, where X is not in the set range. (Failure to find a Perfect Hash would throw an exception, which has not yet happened.) None of this overhead matters in profiling as it is done once at program start.
To find a Test integer in a Set, I call Set.HashFunction(Test), then compare Test to that Set.Array Element. That final compare is the same as each step of a linear search. To be faster, the Hash Function must be faster than the remaining compares of the linear search. So this could be a faster algorithm, but only for large enough set sizes.
I have not experimented to find that set size. Anyway it would depend upon the speed of each hash function.
Related
The array mentioned in the question are as follows:
[1,1,...,1,1,-1,-1,...,-1,-1]
How to quickly find the index of the 1 closest to -1?
Note: Both 1 and -1 will exist at the same time, and the number of 1 and -1 is large.
For example, for an array like this:
[1,1,1,1,1,-1,-1,-1]
the result should be 4.
The fastest way I can think of is binary search, is there a faster way?
With the current representation of the data, binary search is the fastest way I can thing of. Of course, you can cache and reuse the results in constant time since the answer is always the same.
On the other hand if you change the representation of the array to some simple numbers you can find the next element in constant time. Since the data can always be mapped to a binary value, you can reduce the whole array to 2 numbers. The length of the first partition and the length of the second partition. Or the length of the whole array and the partitioning point. This way you can easily change the length of both partitions in constant time and have access to the next element of the second partition in constant time.
Of course, changing the representation of the array itself is a logarithmic process since you need to find the partitioning point.
By a simple information theoretic argument, you can't be faster than log(n) using only comparisons. Because there are n possible outcomes, and you need to collect at least log(n) bits of information to number them.
If you have extra information about the statistical distribution of the values, then maybe you can exploit it. But this is to be discussed on a case-by-case basis.
The problem is to find out all the sequences of length k in a given DNA sequence which occur more than once. I found a approach of using a rolling hash function, where for each sequence of length k, hash is computed and is stored in a map. To check if the current sequence is a repetition, we compute it's hash and check if the hash already exist in the hash map. If yes, then we include this sequence in our result, otherwise add it to the hash map.
Rolling hash here means, when moving on to the next sequence by sliding the window by one, we use the hash of previous sequence in a way that we remove the contribution of the first character of previous sequence and add the contribution of the newly added char i.e. the last character of the new sequence.
Input: AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT
and k=10
Answer: {AAAAACCCCC, CCCCCAAAAA}
This algorithm looks perfect, but I can't go about making a perfect hash function so that collisions are avoided. It would be a great help if somebody can explain how to make a perfect hash under any circumstance and most importantly in this case.
This is actually a research problem.
Let's come to terms with some facts
Input = N, Input length = |N|
You have to move a size k, here k=10, sliding window over the input. Therefore you must live with O(|N|) or more.
Your rolling hash is a form of locality sensitive deterministic hashing, the downside of deterministic hashing is the benefit of hashing is greatly diminished as the more often you encounter similar strings the harder it will be to hash
The longer your input the less effective hashing will be
Given these facts "rolling hashes" will soon fail. You cannot design a rolling hash that will even work for 1/10th of a chromosome.
SO what alternatives do you have?
Bloom Filters. They are much more robust than simple hashing. The downside is sometimes they have a false positives. But this can be mitigated by using several filters.
Cuckoo Hashes similar to bloom filters, but use less memory and have locality sensitive "hashing" and worst case constant lookup time
Just stick every suffix in a suffix trie. Once this is done, just output every string at depth 10 that also has atleast 2 children with one of the children being a leaf.
Improve on the suffix trie with a suffix tree. Lookup is not as straightforward but memory consumption is less.
My favorite the FM-Index. In my opinion the cleanest solution uses the Burrows Wheeler Transform. This technique is also used in industryu tools like Bowtie and BWA
Heads-up: This is not a general solution, but a good trick that you can use when k is not large.
The trick is to encrypt the sequence into an integer by bit manipulation.
If your input k is relatively small, let's say around 10. Then you can encrypt your DNA sequence in an int via bit manipulation. Since for each character in the sequence, there are only 4 possibilities, A, C, G, T. You can simply make your own mapping which uses 2 bits to represent a letter.
For example: 00 -> A, 01 -> C, 10 -> G, 11 -> T.
In this way, if k is 10, you won't need a string with 10 characters as hash key. Instead, you can only use 20 bits in an integer to represent the previous key string.
Then when you do your rolling hash, you left shift the integer that stores your previous sequence for 2 bits, then use any bit operations like |= to set the last two bits with your new character. And remember to clear the 2 left most bits that you just shifted, meaning you are removing them from your sliding window.
By doing this, a string could be stored in an integer, and using that integer as hash key might be nicer and cheaper in terms of the complexity of the hash function computation. If your input length k is slightly longer than 16, you may be able to use a long value. Otherwise, you might be able to use a bitset or a bitarray. But to hash them becomes another issue.
Therefore, I'd say this solution is a nice attempt for this problem when the sequence length is relatively small, i.e. can be stored in a single integer or long integer.
You can build the suffix array and the LCP array. Iterate through the LCP array, every time you see a value greater or equal to k, report the string referred to by that position (using the suffix array to determine where the substring comes from).
After you report a substring because the LCP was greater or equal to k, ignore all following values until reaching one that is less than k (this avoids reporting repeated values).
The construction of both, the suffix array and the LCP, can be done in linear time. So overall the solution is linear with respect to the size of the input plus output.
What you could do is use Chinese Remainder Theorem and pick several large prime moduli. If you recall, CRT means that a system of congruences with coprime moduli has a unique solution mod the product of all your moduli. So if you have three moduli 10^6+3, 10^6+33, and 10^6+37, then in effect you have a modulus of size 10^18 more or less. With a sufficiently large modulus, you can more or less disregard the idea of a collision happening at all---as my instructor so beautifully put it, it's more likely that your computer will spontaneously catch fire than a collision to happen, since you can drive that collision probability to be as arbitrarily small as you like.
I have an array with, for example, 1000000000000 of elements (integers). What is the best approach to pick, for example, only 3 random and unique elements from this array? Elements must be unique in whole array, not in list of N (3 in my example) elements.
I read about Reservoir sampling, but it provides only method to pick random numbers, which can be non-unique.
If the odds of hitting a non-unique value are low, your best bet will be to select 3 random numbers from the array, then check each against the entire array to ensure it is unique - if not, choose another random sample to replace it and repeat the test.
If the odds of hitting a non-unique value are high, this increases the number of times you'll need to scan the array looking for uniqueness and makes the simple solution non-optimal. In that case you'll want to split the task of ensuring unique numbers from the task of making a random selection.
Sorting the array is the easiest way to find duplicates. Most sorting algorithms are O(n log n), but since your keys are integers Radix sort can potentially be faster.
Another possibility is to use a hash table to find duplicates, but that will require significant space. You can use a smaller hash table or Bloom filter to identify potential duplicates, then use another method to go through that smaller list.
counts = [0] * (MAXINT-MININT+1)
for value in Elements:
counts[value] += 1
uniques = [c for c in counts where c==1]
result = random.pick_3_from(uniques)
I assume that you have a reasonable idea what fraction of the array values are likely to be unique. So you would know, for instance, that if you picked 1000 random array values, the odds are good that one is unique.
Step 1. Pick 3 random hash algorithms. They can all be the same algorithm, except that you add different integers to each as a first step.
Step 2. Scan the array. Hash each integer all three ways, and for each hash algorithm, keep track of the X lowest hash codes you get (you can use a priority queue for this), and keep a hash table of how many times each of those integers occurs.
Step 3. For each hash algorithm, look for a unique element in that bucket. If it is already picked in another bucket, find another. (Should be a rare boundary case.)
That is your set of three random unique elements. Every unique triple should have even odds of being picked.
(Note: For many purposes it would be fine to just use one hash algorithm and find 3 things from its list...)
This algorithm will succeed with high likelihood in one pass through the array. What is better yet is that the intermediate data structure that it uses is fairly small and is amenable to merging. Therefore this can be parallelized across machines for a very large data set.
I want to store lots of data so that
they can be accessed by an index,
each data is just yes and no (so probably one bit is enough for each)
I am looking for the data structure which has the highest performance and occupy least space.
probably storing data in a flat memory, one bit per data is not a good choice on the other hand using different type of tree structures still use lots of memory (e.g. pointers in each node are required to make these tree even though each node has just one bit of data).
Does anyone have any Idea?
What's wrong with using a single block of memory and either storing 1 bit per byte (easy indexing, but wastes 7 bits per byte) or packing the data (slightly trickier indexing, but more memory efficient) ?
Well in Java the BitSet might be a good choice http://download.oracle.com/javase/6/docs/api/java/util/BitSet.html
If I understand your question correctly you should store them in an unsigned integer where you assign each value to a bit of the integer (flag).
Say you represent 3 values and they can be on or off. Then you assign the first to 1, the second to 2 and the third to 4. Your unsigned int can then be 0,1,2,3,4,5,6 or 7 depending on which values are on or off and you check the values using bitwise comparison.
Depends on the language and how you define 'index'. If you mean that the index operator must work, then your language will need to be able to overload the index operator. If you don't mind using an index macro or function, you can access the nth element by dividing the given index by the number of bits in your type (say 8 for char, 32 for uint32_t and variants), then return the result of arr[n / n_bits] & (1 << (n % n_bits))
Have a look at a Bloom Filter: http://en.wikipedia.org/wiki/Bloom_filter
It performs very well and is space-efficient. But make sure you read the fine print below ;-): Quote from the above wiki page.
An empty Bloom filter is a bit array
of m bits, all set to 0. There must
also be k different hash functions
defined, each of which maps or hashes
some set element to one of the m array
positions with a uniform random
distribution. To add an element, feed
it to each of the k hash functions to
get k array positions. Set the bits at
all these positions to 1. To query for
an element (test whether it is in the
set), feed it to each of the k hash
functions to get k array positions. If
any of the bits at these positions are
0, the element is not in the set – if
it were, then all the bits would have
been set to 1 when it was inserted. If
all are 1, then either the element is
in the set, or the bits have been set
to 1 during the insertion of other
elements. The requirement of designing
k different independent hash functions
can be prohibitive for large k. For a
good hash function with a wide output,
there should be little if any
correlation between different
bit-fields of such a hash, so this
type of hash can be used to generate
multiple "different" hash functions by
slicing its output into multiple bit
fields. Alternatively, one can pass k
different initial values (such as 0,
1, ..., k − 1) to a hash function that
takes an initial value; or add (or
append) these values to the key. For
larger m and/or k, independence among
the hash functions can be relaxed with
negligible increase in false positive
rate (Dillinger & Manolios (2004a),
Kirsch & Mitzenmacher (2006)).
Specifically, Dillinger & Manolios
(2004b) show the effectiveness of
using enhanced double hashing or
triple hashing, variants of double
hashing, to derive the k indices using
simple arithmetic on two or three
indices computed with independent hash
functions. Removing an element from
this simple Bloom filter is
impossible. The element maps to k
bits, and although setting any one of
these k bits to zero suffices to
remove it, this has the side effect of
removing any other elements that map
onto that bit, and we have no way of
determining whether any such elements
have been added. Such removal would
introduce a possibility for false
negatives, which are not allowed.
One-time removal of an element from a
Bloom filter can be simulated by
having a second Bloom filter that
contains items that have been removed.
However, false positives in the second
filter become false negatives in the
composite filter, which are not
permitted. In this approach re-adding
a previously removed item is not
possible, as one would have to remove
it from the "removed" filter. However,
it is often the case that all the keys
are available but are expensive to
enumerate (for example, requiring many
disk reads). When the false positive
rate gets too high, the filter can be
regenerated; this should be a
relatively rare event.
If I have N arrays, what is the best(Time complexity. Space is not important) way to find the common elements. You could just find 1 element and stop.
Edit: The elements are all Numbers.
Edit: These are unsorted. Please do not sort and scan.
This is not a homework problem. Somebody asked me this question a long time ago. He was using a hash to solve the problem and asked me if I had a better way.
Create a hash index, with elements as keys, counts as values. Loop through all values and update the count in the index. Afterwards, run through the index and check which elements have count = N. Looking up an element in the index should be O(1), combined with looping through all M elements should be O(M).
If you want to keep order specific to a certain input array, loop over that array and test the element counts in the index in that order.
Some special cases:
if you know that the elements are (positive) integers with a maximum number that is not too high, you could just use a normal array as "hash" index to keep counts, where the number are just the array index.
I've assumed that in each array each number occurs only once. Adapting it for more occurrences should be easy (set the i-th bit in the count for the i-th array, or only update if the current element count == i-1).
EDIT when I answered the question, the question did not have the part of "a better way" than hashing in it.
The most direct method is to intersect the first 2 arrays and then intersecting this intersection with the remaining N-2 arrays.
If 'intersection' is not defined in the language in which you're working or you require a more specific answer (ie you need the answer to 'how do you do the intersection') then modify your question as such.
Without sorting there isn't an optimized way to do this based on the information given. (ie sorting and positioning all elements relatively to each other then iterating over the length of the arrays checking for defined elements in all the arrays at once)
The question asks is there a better way than hashing. There is no better way (i.e. better time complexity) than doing a hash as time to hash each element is typically constant. Empirical performance is also favorable particularly if the range of values is can be mapped one to one to an array maintaining counts. The time is then proportional to the number of elements across all the arrays. Sorting will not give better complexity, since this will still need to visit each element at least once, and then there is the log N for sorting each array.
Back to hashing, from a performance standpoint, you will get the best empirical performance by not processing each array fully, but processing only a block of elements from each array before proceeding onto the next array. This will take advantage of the CPU cache. It also results in fewer elements being hashed in favorable cases when common elements appear in the same regions of the array (e.g. common elements at the start of all arrays.) Worst case behaviour is no worse than hashing each array in full - merely that all elements are hashed.
I dont think approach suggested by catchmeifyoutry will work.
Let us say you have two arrays
1: {1,1,2,3,4,5}
2: {1,3,6,7}
then answer should be 1 and 3. But if we use hashtable approach, 1 will have count 3 and we will never find 1, int his situation.
Also problems becomes more complex if we have input something like this:
1: {1,1,1,2,3,4}
2: {1,1,5,6}
Here i think we should give output as 1,1. Suggested approach fails in both cases.
Solution :
read first array and put into hashtable. If we find same key again, dont increment counter. Read second array in same manner. Now in the hashtable we have common elelements which has count as 2.
But again this approach will fail in second input set which i gave earlier.
I'd first start with the degenerate case, finding common elements between 2 arrays (more on this later). From there I'll have a collection of common values which I will use as an array itself and compare it against the next array. This check would be performed N-1 times or until the "carry" array of common elements drops to size 0.
One could speed this up, I'd imagine, by divide-and-conquer, splitting the N arrays into the end nodes of a tree. The next level up the tree is N/2 common element arrays, and so forth and so on until you have an array at the top that is either filled or not. In either case, you'd have your answer.
Without sorting and scanning the best operational speed you'll get for comparing 2 arrays for common elements is O(N2).