I have a set of text files and I'd like to display lines 12-14 by running a bash script on each file.
For one of the files, this works:
tail -14 | head -11
But since other files have different lengths, I cannot run the same script on them.
What is the command I'm looking for to output lines 12-24 of the text file?
Use sed with -n argument
sed -n 12,24p <FILENAME>
For a funny pure Bash (≥4) possibility:
mapfile -t -s 11 -n 13 lines < file
printf '%s\n' "${lines[#]}"
This will skip the first 11 lines (with -s 11) and read 13 lines (with -n 13) and store each line in a field of the array lines.
Using awk:
awk '12<= NR && NR <= 24' file
In awk, NR is the line number. The above condition insists that NR be both greater than or equal to 12 and less than or equal to 24. If it is, then the line is printed. Otherwise, it isn't.
A more efficient solution
It would be more efficient to stop reading the file after the upper line limit has been reached. This solution does that:
awk 'NR>24 {exit;} NR>=12' file
Related
I have a file with 2 columns, and i want to use the values from the second column to set the range in the cut command to select a range of characters from another file. The range i desire is the character in the position of the value in the second column plus the next 10 characters. I will give an example in a while.
My files are something like that:
File with 2 columns and no blank lines between lines (file1.txt):
NAME1 10
NAME2 25
NAME3 48
NAME4 66
File that i want to extract the variable range of characters(just one very long line with no spaces and no bold font) (file2.txt):
GATCGAGCGGGATTCTTTTTTTTTAGGCGAGTCAGCTAGCATCAGCTACGAGAGGCGAGGGCGGGCTATCACGACTACGACTACGACTACAGCATCAGCATCAGCGCACTAGAGCGAGGCTAGCTAGCTACGACTACGATCAGCATCGCACATCGACTACGATCAGCATCAGCTACGCATCGAAGAGAGAGC
...or, more literally (for copy/paste to test):
GATCGAGCGGGATTCTTTTTTTTTAGGCGAGTCAGCTAGCATCAGCTACGAGAGGCGAGGGCGGGCTATCACGACTACGACTACGACTACAGCATCAGCATCAGCGCACTAGAGCGAGGCTAGCTAGCTACGACTACGATCAGCATCGCACATCGACTACGATCAGCATCAGCTACGCATCGAAGAGAGAGC
Desired resulting file, one sequence per line (result.txt):
GATTCTTTTT
GGCGAGTCAG
CGAGAGGCGA
TATCACGACT
The resulting file would have the characters from 10-20, 25-35, 48-58 and 66-76, each range in a new line. So, it would always keep the range of 10, but in different start points and those start points are set by the values in the second column from the first file.
I tried the command:
for i in $(awk '{print $2}' file1.txt);
do
p1=$i;
p2=`expr "$1" + 10`
cut -c$p1-$2 file2.txt > result.txt;
done
I don't get any output or error message.
I also tried:
while read line; do
set $line
p2=`expr "$2" + 10`
cut -c$2-$p2 file2.txt > result.txt;
done <file1.txt
This last command gives me an error message:
cut: invalid range with no endpoint: -
Try 'cut --help' for more information.
expr: non-integer argument
There's no need for cut here; dd can do the job of indexing into a file, and reading only the number of bytes you want. (Note that status=none is a GNUism; you may need to leave it out on other platforms and redirect stderr otherwise if you want to suppress informational logging).
while read -r name index _; do
dd if=file2.txt bs=1 skip="$index" count=10 status=none
printf '\n'
done <file1.txt >result.txt
This approach avoids excessive memory requirements (as present when reading the whole of file2 -- assuming it's large), and has bounded performance requirements (overhead is equal to starting one copy of dd per sequence to extract).
Using awk
$ awk 'FNR==NR{a=$0; next} {print substr(a,$2+1,10)}' file2 file1
GATTCTTTTT
GGCGAGTCAG
CGAGAGGCGA
TATCACGACT
If file2.txt is not too large, then you can read it in memory,
and use Bash sub-strings to extract the desired ranges:
data=$(<file2.txt)
while read -r name index _; do
echo "${data:$index:10}"
done <file1.txt >result.txt
This will be much more efficient than running cut or another process for every single range definition.
(Thanks to #CharlesDuffy for the tip to read data without a useless cat, and the while loop.)
One way to solve it:
#!/bin/bash
while read line; do
pos=$(echo "$line" | cut -f2 -d' ')
x=$(head -c $(( $pos + 10 )) file2.txt | tail -c 10)
echo "$x"
done < file1.txt > result.txt
It's not the solution an experienced bash hacker would use, but it is very good for someone who is new to bash. It uses tools that are very versatile, although somewhat bad if you need high performance. Shell scripting is commonly used by people who rarely shell scripts, but knows a few commands and just wants to get the job done. That's why I'm including this solution, even if the other answers are superior for more experienced people.
The first line is pretty easy. It just extracts the numbers from file1.txt. The second line uses the very nice tools head and tail. Usually, they are used with lines instead of characters. Nevertheless, I print the first pos + 10 characters with head. The result is piped into tail which prints the last 10 characters.
Thanks to #CharlesDuffy for improvements.
How to get the first few lines from a gziped file ?
I tried zcat, but its throwing an error
zcat CONN.20111109.0057.gz|head
CONN.20111109.0057.gz.Z: A file or directory in the path name does not exist.
zcat(1) can be supplied by either compress(1) or by gzip(1). On your system, it appears to be compress(1) -- it is looking for a file with a .Z extension.
Switch to gzip -cd in place of zcat and your command should work fine:
gzip -cd CONN.20111109.0057.gz | head
Explanation
-c --stdout --to-stdout
Write output on standard output; keep original files unchanged. If there are several input files, the output consists of a sequence of independently compressed members. To obtain better compression, concatenate all input files before compressing
them.
-d --decompress --uncompress
Decompress.
On some systems (e.g., Mac), you need to use gzcat.
On a mac you need to use the < with zcat:
zcat < CONN.20111109.0057.gz|head
If a continuous range of lines needs be, one option might be:
gunzip -c file.gz | sed -n '5,10p;11q' > subFile
where the lines between 5th and 10th lines (both inclusive) of file.gz are extracted into a new subFile. For sed options, refer to the manual.
If every, say, 5th line is required:
gunzip -c file.gz | sed -n '1~5p;6q' > subFile
which extracts the 1st line and jumps over 4 lines and picks the 5th line and so on.
If you want to use zcat, this will show the first 10 rows
zcat your_filename.gz | head
Let's say you want the 16 first row
zcat your_filename.gz | head -n 16
This awk snippet will let you show not only the first few lines - but a range you can specify. It will also add line numbers which i needed for debugging an error message pointing to a certain line way down in a gzipped file.
gunzip -c file.gz | awk -v from=10 -v to=20 'NR>=from { print NR,$0; if (NR>=to) exit 1}'
Here is the awk snippet used in the one liner above. In awk NR is a built-in variable (Number of records found so far) which usually is equivalent to a line number. the from and to variable are picked up from the command line via the -v options.
NR>=from {
print NR,$0;
if (NR>=to)
exit 1
}
I have multiple files which have the same structure but not the same data. Say their names are values_#####.txt (values_00001.txt, values_00002.txt, etc.).
I want to extract a specific line from each file and copy it in another file. For example, I want to extract the 8th line from values_00001.txt, the 16th line from values_00002.txt, the 24th line from values_00003.txt and so on (increment = 8 each time), and copy them line by line in a new file (say values.dat).
I am new to shell scripting, I tried to use sed, but I didn't figure out how to do that.
Thank you in advance for your answers !
I believe ordering of files is also important to make sure you get output in desired sequence.
Consider this script:
n=8
while read f; do
sed $n'q;d' "$f" >> output.txt
((n+=8))
done < <(printf "%s\n" values_*.txt|sort -t_ -nk2,2)
This can make it:
for var in {1..NUMBER}
do
awk -v line=$var 'NR==8*line' values_${var}.txt >> values.dat
done
Explanation
The for loop is basic.
-v line=$var "gives" the $var value to awk, so it can be used with the variable line.
'NR==8*line' prints the line number 8*{value we are checking}.
values_${var}.txt gets the file values_1.txt, values_2.txt, and so on.
>> values.dat redirects to values.dat file.
Test
I created 3 equal files a1, a2, a3. They contain 30 lines, being each one the line number:
$ cat a1
1
2
3
4
...
Executing the one liner:
$ for var in {1..3}; do awk -v line=$var 'NR==8*line' a${var} >> values.dat; done
$ cat values.dat
8
16
24
This question already has answers here:
How to get the part of a file after the first line that matches a regular expression
(12 answers)
Closed 7 years ago.
I have a file that contains a list of URLs. It looks like below:
file1:
http://www.google.com
http://www.bing.com
http://www.yahoo.com
http://www.baidu.com
http://www.yandex.com
....
I want to get all the records after: http://www.yahoo.com, results looks like below:
file2:
http://www.baidu.com
http://www.yandex.com
....
I know that I could use grep to find the line number of where yahoo.com lies using
grep -n 'http://www.yahoo.com' file1
3 http://www.yahoo.com
But I don't know how to get the file after line number 3. Also, I know there is a flag in grep -A print the lines after your match. However, you need to specify how many lines you want after the match. I am wondering is there something to get around that issue. Like:
Pseudocode:
grep -n 'http://www.yahoo.com' -A all file1 > file2
I know we could use the line number I got and wc -l to get the number of lines after yahoo.com, however... it feels pretty lame.
AWK
If you don't mind using AWK:
awk '/yahoo/{y=1;next}y' data.txt
This script has two parts:
/yahoo/ { y = 1; next }
y
The first part states that if we encounter a line with yahoo, we set the variable y=1, and then skip that line (the next command will jump to the next line, thus skip any further processing on the current line). Without the next command, the line yahoo will be printed.
The second part is a short hand for:
y != 0 { print }
Which means, for each line, if variable y is non-zero, we print that line. In AWK, if you refer to a variable, that variable will be created and is either zero or empty string, depending on context. Before encounter yahoo, variable y is 0, so the script does not print anything. After encounter yahoo, y is 1, so every line after that will be printed.
Sed
Or, using sed, the following will delete everything up to and including the line with yahoo:
sed '1,/yahoo/d' data.txt
This is much easier done with sed than grep. sed can apply any of its one-letter commands to an inclusive range of lines; the general syntax for this is
START , STOP COMMAND
except without any spaces. START and STOP can each be a number (meaning "line number N", starting from 1); a dollar sign (meaning "the end of the file"), or a regexp enclosed in slashes, meaning "the first line that matches this regexp". (The exact rules are slightly more complicated; the GNU sed manual has more detail.)
So, you can do what you want like so:
sed -n -e '/http:\/\/www\.yahoo\.com/,$p' file1 > file2
The -n means "don't print anything unless specifically told to", and the -e directive means "from the first appearance of a line that matches the regexp /http:\/\/www\.yahoo\.com/ to the end of the file, print."
This will include the line with http://www.yahoo.com/ on it in the output. If you want everything after that point but not that line itself, the easiest way to do that is to invert the operation:
sed -e '1,/http:\/\/www\.yahoo\.com/d' file1 > file2
which means "for line 1 through the first line matching the regexp /http:\/\/www\.yahoo\.com/, delete the line" (and then, implicitly, print everything else; note that -n is not used this time).
awk '/yahoo/ ? c++ : c' file1
Or golfed
awk '/yahoo/?c++:c' file1
Result
http://www.baidu.com
http://www.yandex.com
This is most easily done in Perl:
perl -ne 'print unless 1 .. m(http://www\.yahoo\.com)' file
In other words, print all lines that aren’t between line 1 and the first occurrence of that pattern.
Using this script:
# Get index of the "yahoo" word
index=`grep -n "yahoo" filepath | cut -d':' -f1`
# Get the total number of lines in the file
totallines=`wc -l filepath | cut -d' ' -f1`
# Subtract totallines with index
result=`expr $total - $index`
# Gives the desired output
grep -A $result "yahoo" filepath
I've a text file with 2 million lines. Each line has some transaction information.
e.g.
23848923748, sample text, feild2 , 12/12/2008
etc
What I want to do is create a new file from a certain unique transaction number onwards. So I want to split the file at the line where this number exists.
How can I do this form the command line?
I can find the line by doing this:
cat myfile.txt | grep 23423423423
use sed like this
sed '/23423423423/,$!d' myfile.txt
Just confirm that the unique transaction number cannot appear as a pattern in some other part of the line (especially, before the correctly matching line) in your file.
There is already a 'perl' answer here, so, i'll give one more AWK way :-)
awk '{BEGIN{skip=1} /number/ {skip=0} // {if (skip!=1) print $0}' myfile.txt
On a random file in my tmp directory, this is how I output everything from the line matching popd onwards in a file named tmp.sh:
tail -n+`grep -n popd tmp.sh | cut -f 1 -d:` tmp.sh
tail -n+X matches from that line number onwards; grep -n outputs lineno:filename, and cut extracts just lineno from grep.
So for your case it would be:
tail -n+`grep -n 23423423423 myfile.txt | cut -f 1 -d:` myfile.txt
And it should indeed match from the first occurrence onwards.
It's not a pretty solution, but how about using -A parameter of grep?
Like this:
mc#zolty:/tmp$ cat a
1
2
3
4
5
6
7
mc#zolty:/tmp$ cat a | grep 3 -A1000000
3
4
5
6
7
The only problem I see in this solution is the 1000000 magic number. Probably someone will know the answer without using such a trick.
You can probably get the line number using Grep and then use Tail to print the file from that point into your output file.
Sorry I don't have actual code to show, but hopefully the idea is clear.
I would write a quick Perl script, frankly. It's invaluable for anything like this (relatively simple issues) and as soon as something more complex rears its head (as it will do!) then you'll need the extra power.
Something like:
#!/bin/perl
my $out = 0;
while (<STDIN>) {
if /23423423423/ then $out = 1;
print $_ if $out;
}
and run it using:
$ perl mysplit.pl < input > output
Not tested, I'm afraid.