How to loop a variable range in cut command - bash

Question

I have a file with 2 columns, and i want to use the values from the second column to set the range in the cut command to select a range of characters from another file. The range i desire is the character in the position of the value in the second column plus the next 10 characters. I will give an example in a while.
My files are something like that:
File with 2 columns and no blank lines between lines (file1.txt):
NAME1 10
NAME2 25
NAME3 48
NAME4 66
File that i want to extract the variable range of characters(just one very long line with no spaces and no bold font) (file2.txt):
GATCGAGCGGGATTCTTTTTTTTTAGGCGAGTCAGCTAGCATCAGCTACGAGAGGCGAGGGCGGGCTATCACGACTACGACTACGACTACAGCATCAGCATCAGCGCACTAGAGCGAGGCTAGCTAGCTACGACTACGATCAGCATCGCACATCGACTACGATCAGCATCAGCTACGCATCGAAGAGAGAGC
...or, more literally (for copy/paste to test):
GATCGAGCGGGATTCTTTTTTTTTAGGCGAGTCAGCTAGCATCAGCTACGAGAGGCGAGGGCGGGCTATCACGACTACGACTACGACTACAGCATCAGCATCAGCGCACTAGAGCGAGGCTAGCTAGCTACGACTACGATCAGCATCGCACATCGACTACGATCAGCATCAGCTACGCATCGAAGAGAGAGC
Desired resulting file, one sequence per line (result.txt):
GATTCTTTTT
GGCGAGTCAG
CGAGAGGCGA
TATCACGACT
The resulting file would have the characters from 10-20, 25-35, 48-58 and 66-76, each range in a new line. So, it would always keep the range of 10, but in different start points and those start points are set by the values in the second column from the first file.
I tried the command:
for i in $(awk '{print $2}' file1.txt);
do
p1=$i;
p2=`expr "$1" + 10`
cut -c$p1-$2 file2.txt > result.txt;
done
I don't get any output or error message.
I also tried:
while read line; do
set $line
p2=`expr "$2" + 10`
cut -c$2-$p2 file2.txt > result.txt;
done <file1.txt
This last command gives me an error message:
cut: invalid range with no endpoint: -
Try 'cut --help' for more information.
expr: non-integer argument

Answer 1

There's no need for cut here; dd can do the job of indexing into a file, and reading only the number of bytes you want. (Note that status=none is a GNUism; you may need to leave it out on other platforms and redirect stderr otherwise if you want to suppress informational logging).
while read -r name index _; do
dd if=file2.txt bs=1 skip="$index" count=10 status=none
printf '\n'
done <file1.txt >result.txt
This approach avoids excessive memory requirements (as present when reading the whole of file2 -- assuming it's large), and has bounded performance requirements (overhead is equal to starting one copy of dd per sequence to extract).

Answer 2

Using awk
$ awk 'FNR==NR{a=$0; next} {print substr(a,$2+1,10)}' file2 file1
GATTCTTTTT
GGCGAGTCAG
CGAGAGGCGA
TATCACGACT

Answer 3

If file2.txt is not too large, then you can read it in memory,
and use Bash sub-strings to extract the desired ranges:
data=$(<file2.txt)
while read -r name index _; do
echo "${data:$index:10}"
done <file1.txt >result.txt
This will be much more efficient than running cut or another process for every single range definition.
(Thanks to #CharlesDuffy for the tip to read data without a useless cat, and the while loop.)

Answer 4

One way to solve it:
#!/bin/bash
while read line; do
pos=$(echo "$line" | cut -f2 -d' ')
x=$(head -c $(( $pos + 10 )) file2.txt | tail -c 10)
echo "$x"
done < file1.txt > result.txt
It's not the solution an experienced bash hacker would use, but it is very good for someone who is new to bash. It uses tools that are very versatile, although somewhat bad if you need high performance. Shell scripting is commonly used by people who rarely shell scripts, but knows a few commands and just wants to get the job done. That's why I'm including this solution, even if the other answers are superior for more experienced people.
The first line is pretty easy. It just extracts the numbers from file1.txt. The second line uses the very nice tools head and tail. Usually, they are used with lines instead of characters. Nevertheless, I print the first pos + 10 characters with head. The result is piped into tail which prints the last 10 characters.
Thanks to #CharlesDuffy for improvements.