I'm writing a bash script that would allow me to take a certain amount of text from a file and add some other text before that for a list of files.
directory=$(pwd)
for f in *test.txt
do
filename=$(basename $f .txt)
printf "%%sum=4 \n"> input.temp
printf "file=$directory"/"$filename".txt" \n">> input.temp
printf "some commands \n">> input.temp
printf "\n" >> input.temp
printf "description \n">> input.temp
sed -n "/0 1/,$p" "$f" >> input.temp;
mv input.temp $filename.temp
done
I have a problem with the sed command inside the for loop. I looked around and people suggest adding double quotes which I did but to no avail. I think it might be the $p.
I hope this is clear enough. If it's not, I'll try to explain better.
sed -n "/0 1/,$p" "$f" >> input.temp; does not work
sed -n '/0 1/,$p' "$f" >> input.temp; does not work
sed -n "/0 1/,\$p" "$f" >> input.temp; does not work
FYI I'm not trying to find something else that works. I want to fix this exact input. I sound like an asshole I'm sure.
Sample input
%sum=8
file=otherpath/filename.txt
some other commands
another description
0 1
0.36920852 -0.56246512
0.77541848 0.05756533
2.05409026 0.62333039
2.92655258 0.56906375
2.52034254 -0.05096652
1.24167014 -0.61673008
-0.60708600 -0.99443872
0.10927459 0.09899803
3.90284624 1.00103940
3.18648588 -0.09239788
0.93151968 -1.09013674
2.50047427 1.30468389
2.19361322 2.54108378
3.18742399 0.34152442
3.38679424 1.11276220
1.56936488 3.27250306
1.81754180 4.19564055
1 2 1.5 6
2 3 1.5
3 4
4 5 1.5
5 6 1.5
6 11 1.0
7
8
9
10
11
12
13 16
14
15
16 17
17
My desired output is basically this file from "0 1" till the end preceded by the stuff I put inside the printf.
UPDATE: If you're interested, the two scripts tripleee and Ed Morton provided work perfectly well. The problem in my script was me leaving out the -i option from the sed line (for inplace).
sed -n "/0 1/,$p" "$f" >> input.temp
should be replaced by
sed -ni '/0 1/,$p' "$f"
I see you updated your question and provided some additional information in your comments so try this, uses GNU awk 4.* for -i inplace:
awk -i inplace -v directory="$(pwd)" '
FNR==1 {
print "%%sum=4 "
print "file=" directory "/" FILENAME
print "some commands "
print ""
print "description "
found = 0
}
/0 1/ { found = 1 }
found
' *text.txt
If you don't have GNU awk then the technically correct way to do it is using xargs but it's simpler using a shell loop for the file manipulation (moving) part:
for file in *test.txt
do
awk -v directory="$(pwd)" '
FNR==1 {
print "%%sum=4 "
print "file=" directory "/" FILENAME
print "some commands "
print ""
print "description "
found = 0
}
/0 1/ { found = 1 }
found
' "$file" > tmp && mv tmp "$file"
done
Like others have already commented, you basically just need to use single quotes instead of double, because $p in double quotes gets replaced with the value of the shell variable p by the shell, before sed executes (in practice, probably an empty string).
However, you might also want to investigate doing it all in sed. You might then instead stick with the double quotes (because there are other variables you do want to substitute) and instead escape the dollar sign in $p with a backslash to protect it from the shell.
directory=$(pwd) # just do this once before the loop; the value doesn't change
for f in *text.txt; do
# no braces
filename=$(basename "$f" .txt)
sed -n "1i\\
%sum=4\\
file=$directory/$filename.txt\\
some commands\\
\\
description
/0 1/,\$p" "$f" >inputout.temp2 # no pointless separate temp file
done
In practice, I imagine you would like for the output file to be different in each iteration (maybe "$filename.temp" instead?) but what you do about that is up to you, obviously. As it is now, the file will contain the output from the last iteration.
Related
my bash for loop looks like:
for i in read_* ; do
cut -f1 $i | sponge $i
sed -i '1 s/^/>/g' $i
sed -i '3 s/^/>ref\n/g' $i
sed -i '4d' $i
sed -i '1h;2H;1,2d;4G' $i
mv $i $i.fasta
done
Are there any methods of speeding up this process, perhaps using GNU parallel?
EDIT: Added input and expected output.
Input:
sampleid 97 stuff 2086 42 213M = 3322 1431
TATTTAGGGAAGATCTGGCCTTCCTACAAGGGAAGGCCAGGGAATTTTCTTCAGAGCAGA
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
TTTTTAGGGAAGATCTGGCCTTCCTACAAGGGAAGGCCAGGGAATTTTCTTCAGAGCAGA
Hopeful output:
>ref
TTTTTAGGGAAGATCTGGCCTTCCTACAAGGGAAGGCCAGGGAATTTTCTTCAGAGCAGA
>sampleid
TATTTAGGGAAGATCTGGCCTTCCTACAAGGGAAGGCCAGGGAATTTTCTTCAGAGCAGA
I used the sed -i '1h;2H;1,2d;4G' $i command to swap lines 2 and 4.
If I read it right, this should create the same result, though it would probably help a LOT if I could see what your input and expected output look like...
awk '{$0=$1}
FNR==1{hd=">"$0; next}
FNR==2{hd=hd"\n"$0;next}
FNR==3{print ">ref\n"$0 > FILENAME".fasta"}
FNR==4{next}
FNR==5{print hd"\n"$0 > FILENAME".fasta"}
' read_*
My input files:
$: cat read_x
foo x
bar x
baz x
last x
curiosity x
$: cat read_y
FOO y
BAR y
BAZ y
LAST y
CURIOSITY y
and the resulting output files:
$: cat read_x.fasta
>ref
baz
>foo
bar
curiosity
$: cat read_y.fasta
>ref
BAZ
>FOO
BAR
CURIOSITY
This runs in one pass with no loop aside from awk's usual internals, and leaves the originals in place so you can check it first. If all is good, all that's left is to remove the originals. For that, I would use extended globbing.
$: shopt -s extglob; rm read_!(*.fasta)
That will clean up the original inputs but not the new outputs.
Same results, three commands, no loops.
I am, or course, making some assumptions about what you are meaning to do that might not be accurate. To get this format in a single sed call -
$: sed -e 's/[[:space:]].*//' -e '1{s/^/>/;h;d}' -e '2{H;s/.*/>ref/}' -e '4x' read_x
>ref
baz
>foo
bar
curiosity
but that's not the same commands you used, so maybe I'm misreading it.
To use this to in-place edit multiple files at a time (instead of calling it in a loop on each file), use -si so that the line numbers apply to each file rather than the stream of records they collectively produce.
DON'T use -is, though you could use -i -s.
$: sed -s -i -e 's/[[:space:]].*//' -e '1{s/^/>/;h;d}' -e '2{H;s/.*/>ref/}' -e '4x' read_*
This still leaves you with the issue of renaming each, but xargs makes that pretty easy in the given example.
printf "%s\n" read_* | xargs -I# mv # #.fasta
addendum
Using the file you gave in the OP, assuming every file is the same general structure and exactly 4 lines -
$: cat file_0 # I made files 0 through 7, but with same data
sampleid 97 stuff 2086 42 213M = 3322 1431
TATTTAGGGAAGATCTGGCCTTCCTACAAGGGAAGGCCAGGGAATTTTCTTCAGAGCAGA
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
TTTTTAGGGAAGATCTGGCCTTCCTACAAGGGAAGGCCAGGGAATTTTCTTCAGAGCAGA
$: sed -Esi '1{s/^([^[:space:]]+).*/>\1/;h;s/.*/>ref/}; 3x;' file_?
$: cat file_0 # used a diff on each, worked on all at once
>ref
TATTTAGGGAAGATCTGGCCTTCCTACAAGGGAAGGCCAGGGAATTTTCTTCAGAGCAGA
>sampleid
TTTTTAGGGAAGATCTGGCCTTCCTACAAGGGAAGGCCAGGGAATTTTCTTCAGAGCAGA
Breakout:
-Esi Extended pattern matching, separate file linecounts, in-place edits
1{...}; Collectively do these commands, in order, only on every line 1
s/^([^[:space:]]+).*/>\1/ add leading > but strip everything after any whitespace
h store the resulting >\1 line in the hold buffer
s/.*/>ref/ then replace the whole line with a literal >ref
`3x' swap line 3 with the value in the hold buffer from line 1
file_? I used a glob to supply the appropriate list of files all at once.
Doing same with awk:
$: awk 'FNR==1{id=">"$1; print ">ref" >FILENAME".fasta"; next} FNR==3{print id > FILENAME".fasta"; next} {print $0 > FILENAME".fasta"}' file_?
Then you can do file management as above with the xargs/mv for the sed or the shopt/rm for the awk - or we could add a little organizational work in awk if you like. Consider this:
awk 'BEGIN { system(" mkdir -p done ") }
FNR==1 { id=">"$1; print ">ref" > FILENAME".fasta"; next } # skip printing original
FNR==3 { print id > FILENAME".fasta"; next } # skip printing original
{ print $0 > FILENAME".fasta" } # every line NOT skipped
FNR==4 { close(FILENAME); close(FILENAME".fasta");
system("mv " FILENAME " done/")
}' file_?
Then if there are any problems, it's easy to delete the fasta's, move the originals back, adjust the code, and try again. If everything is ok, it's fast and easy to rm -fr done, yes?
Note that I really only added the mkdir inside a system call in the awk to show that you can, and to keep from having to manually do it separately if you have to run a few iterations or move it all into a wrapper script, etc.
The code in the question runs multiple subprocesses (cut, sponge, sed four times, and mv) for each file that is processed. Running subprocesses is relatively slow, so you can speed up the code significantly by reducing the number of them.
This Shellcheck-clean code is one way to do it:
#! /bin/bash -p
old_files=()
for f in read_* ; do
readarray -t lines <"$f"
printf '>ref\n%s\n>%s\n%s\n' \
"${lines[3]}" "${lines[0]%%[[:space:]]*}" "${lines[1]}" >"$f.fasta"
old_files+=( "$f" )
done
rm -- "${old_files[#]}"
This runs no subprocesses when processing individual files. It just reads the lines of the old file into an array using the built-in readarray command and writes to the new file using the built-in printf.
See Removing part of a string (BashFAQ/100 (How do I do string manipulation in bash?)) for an explanation of the %% in ${lines[0]%%[[:space:]]*}.
To avoid running rm for each file, the code keeps a list of files to be deleted and removes all of them at the end. If you try the code, consider commenting the rm line until you are very confident that the rest of the code is doing what you want.
In my bash script I have an external (received from user) string, which I should use in sed pattern.
REPLACE="<funny characters here>"
sed "s/KEYWORD/$REPLACE/g"
How can I escape the $REPLACE string so it would be safely accepted by sed as a literal replacement?
NOTE: The KEYWORD is a dumb substring with no matches etc. It is not supplied by user.
Warning: This does not consider newlines. For a more in-depth answer, see this SO-question instead. (Thanks, Ed Morton & Niklas Peter)
Note that escaping everything is a bad idea. Sed needs many characters to be escaped to get their special meaning. For example, if you escape a digit in the replacement string, it will turn in to a backreference.
As Ben Blank said, there are only three characters that need to be escaped in the replacement string (escapes themselves, forward slash for end of statement and & for replace all):
ESCAPED_REPLACE=$(printf '%s\n' "$REPLACE" | sed -e 's/[\/&]/\\&/g')
# Now you can use ESCAPED_REPLACE in the original sed statement
sed "s/KEYWORD/$ESCAPED_REPLACE/g"
If you ever need to escape the KEYWORD string, the following is the one you need:
sed -e 's/[]\/$*.^[]/\\&/g'
And can be used by:
KEYWORD="The Keyword You Need";
ESCAPED_KEYWORD=$(printf '%s\n' "$KEYWORD" | sed -e 's/[]\/$*.^[]/\\&/g');
# Now you can use it inside the original sed statement to replace text
sed "s/$ESCAPED_KEYWORD/$ESCAPED_REPLACE/g"
Remember, if you use a character other than / as delimiter, you need replace the slash in the expressions above wih the character you are using. See PeterJCLaw's comment for explanation.
Edited: Due to some corner cases previously not accounted for, the commands above have changed several times. Check the edit history for details.
The sed command allows you to use other characters instead of / as separator:
sed 's#"http://www\.fubar\.com"#URL_FUBAR#g'
The double quotes are not a problem.
The only three literal characters which are treated specially in the replace clause are / (to close the clause), \ (to escape characters, backreference, &c.), and & (to include the match in the replacement). Therefore, all you need to do is escape those three characters:
sed "s/KEYWORD/$(echo $REPLACE | sed -e 's/\\/\\\\/g; s/\//\\\//g; s/&/\\\&/g')/g"
Example:
$ export REPLACE="'\"|\\/><&!"
$ echo fooKEYWORDbar | sed "s/KEYWORD/$(echo $REPLACE | sed -e 's/\\/\\\\/g; s/\//\\\//g; s/&/\\\&/g')/g"
foo'"|\/><&!bar
Based on Pianosaurus's regular expressions, I made a bash function that escapes both keyword and replacement.
function sedeasy {
sed -i "s/$(echo $1 | sed -e 's/\([[\/.*]\|\]\)/\\&/g')/$(echo $2 | sed -e 's/[\/&]/\\&/g')/g" $3
}
Here's how you use it:
sedeasy "include /etc/nginx/conf.d/*" "include /apps/*/conf/nginx.conf" /etc/nginx/nginx.conf
It's a bit late to respond... but there IS a much simpler way to do this. Just change the delimiter (i.e., the character that separates fields). So, instead of s/foo/bar/ you write s|bar|foo.
And, here's the easy way to do this:
sed 's|/\*!50017 DEFINER=`snafu`#`localhost`\*/||g'
The resulting output is devoid of that nasty DEFINER clause.
It turns out you're asking the wrong question. I also asked the wrong question. The reason it's wrong is the beginning of the first sentence: "In my bash script...".
I had the same question & made the same mistake. If you're using bash, you don't need to use sed to do string replacements (and it's much cleaner to use the replace feature built into bash).
Instead of something like, for example:
function escape-all-funny-characters() { UNKNOWN_CODE_THAT_ANSWERS_THE_QUESTION_YOU_ASKED; }
INPUT='some long string with KEYWORD that need replacing KEYWORD.'
A="$(escape-all-funny-characters 'KEYWORD')"
B="$(escape-all-funny-characters '<funny characters here>')"
OUTPUT="$(sed "s/$A/$B/g" <<<"$INPUT")"
you can use bash features exclusively:
INPUT='some long string with KEYWORD that need replacing KEYWORD.'
A='KEYWORD'
B='<funny characters here>'
OUTPUT="${INPUT//"$A"/"$B"}"
Use awk - it is cleaner:
$ awk -v R='//addr:\\file' '{ sub("THIS", R, $0); print $0 }' <<< "http://file:\_THIS_/path/to/a/file\\is\\\a\\ nightmare"
http://file:\_//addr:\file_/path/to/a/file\\is\\\a\\ nightmare
Here is an example of an AWK I used a while ago. It is an AWK that prints new AWKS. AWK and SED being similar it may be a good template.
ls | awk '{ print "awk " "'"'"'" " {print $1,$2,$3} " "'"'"'" " " $1 ".old_ext > " $1 ".new_ext" }' > for_the_birds
It looks excessive, but somehow that combination of quotes works to keep the ' printed as literals. Then if I remember correctly the vaiables are just surrounded with quotes like this: "$1". Try it, let me know how it works with SED.
These are the escape codes that I've found:
* = \x2a
( = \x28
) = \x29
" = \x22
/ = \x2f
\ = \x5c
' = \x27
? = \x3f
% = \x25
^ = \x5e
sed is typically a mess, especially the difference between gnu-sed and bsd-sed
might just be easier to place some sort of sentinel at the sed side, then a quick pipe over to awk, which is far more flexible in accepting any ERE regex, escaped hex, or escaped octals.
e.g. OFS in awk is the true replacement ::
date | sed -E 's/[0-9]+/\xC1\xC0/g' |
mawk NF=NF FS='\xC1\xC0' OFS='\360\237\244\241'
1 Tue Aug 🤡 🤡:🤡:🤡 EDT 🤡
(tested and confirmed working on both BSD-sed and GNU-sed - the emoji isn't a typo that's what those 4 bytes map to in UTF-8 )
There are dozens of answers out there... If you don't mind using a bash function schema, below is a good answer. The objective below was to allow using sed with practically any parameter as a KEYWORD (F_PS_TARGET) or as a REPLACE (F_PS_REPLACE). We tested it in many scenarios and it seems to be pretty safe. The implementation below supports tabs, line breaks and sigle quotes for both KEYWORD and replace REPLACE.
NOTES: The idea here is to use sed to escape entries for another sed command.
CODE
F_REVERSE_STRING_R=""
f_reverse_string() {
: 'Do a string reverse.
To undo just use a reversed string as STRING_INPUT.
Args:
STRING_INPUT (str): String input.
Returns:
F_REVERSE_STRING_R (str): The modified string.
'
local STRING_INPUT=$1
F_REVERSE_STRING_R=$(echo "x${STRING_INPUT}x" | tac | rev)
F_REVERSE_STRING_R=${F_REVERSE_STRING_R%?}
F_REVERSE_STRING_R=${F_REVERSE_STRING_R#?}
}
# [Ref(s).: https://stackoverflow.com/a/2705678/3223785 ]
F_POWER_SED_ECP_R=""
f_power_sed_ecp() {
: 'Escape strings for the "sed" command.
Escaped characters will be processed as is (e.g. /n, /t ...).
Args:
F_PSE_VAL_TO_ECP (str): Value to be escaped.
F_PSE_ECP_TYPE (int): 0 - For the TARGET value; 1 - For the REPLACE value.
Returns:
F_POWER_SED_ECP_R (str): Escaped value.
'
local F_PSE_VAL_TO_ECP=$1
local F_PSE_ECP_TYPE=$2
# NOTE: Operational characters of "sed" will be escaped, as well as single quotes.
# By Questor
if [ ${F_PSE_ECP_TYPE} -eq 0 ] ; then
# NOTE: For the TARGET value. By Questor
F_POWER_SED_ECP_R=$(echo "x${F_PSE_VAL_TO_ECP}x" | sed 's/[]\/$*.^[]/\\&/g' | sed "s/'/\\\x27/g" | sed ':a;N;$!ba;s/\n/\\n/g')
else
# NOTE: For the REPLACE value. By Questor
F_POWER_SED_ECP_R=$(echo "x${F_PSE_VAL_TO_ECP}x" | sed 's/[\/&]/\\&/g' | sed "s/'/\\\x27/g" | sed ':a;N;$!ba;s/\n/\\n/g')
fi
F_POWER_SED_ECP_R=${F_POWER_SED_ECP_R%?}
F_POWER_SED_ECP_R=${F_POWER_SED_ECP_R#?}
}
# [Ref(s).: https://stackoverflow.com/a/24134488/3223785 ,
# https://stackoverflow.com/a/21740695/3223785 ,
# https://unix.stackexchange.com/a/655558/61742 ,
# https://stackoverflow.com/a/11461628/3223785 ,
# https://stackoverflow.com/a/45151986/3223785 ,
# https://linuxaria.com/pills/tac-and-rev-to-see-files-in-reverse-order ,
# https://unix.stackexchange.com/a/631355/61742 ]
F_POWER_SED_R=""
f_power_sed() {
: 'Facilitate the use of the "sed" command. Replaces in files and strings.
Args:
F_PS_TARGET (str): Value to be replaced by the value of F_PS_REPLACE.
F_PS_REPLACE (str): Value that will replace F_PS_TARGET.
F_PS_FILE (Optional[str]): File in which the replacement will be made.
F_PS_SOURCE (Optional[str]): String to be manipulated in case "F_PS_FILE" was
not informed.
F_PS_NTH_OCCUR (Optional[int]): [1~n] - Replace the nth match; [n~-1] - Replace
the last nth match; 0 - Replace every match; Default 1.
Returns:
F_POWER_SED_R (str): Return the result if "F_PS_FILE" is not informed.
'
local F_PS_TARGET=$1
local F_PS_REPLACE=$2
local F_PS_FILE=$3
local F_PS_SOURCE=$4
local F_PS_NTH_OCCUR=$5
if [ -z "$F_PS_NTH_OCCUR" ] ; then
F_PS_NTH_OCCUR=1
fi
local F_PS_REVERSE_MODE=0
if [ ${F_PS_NTH_OCCUR} -lt -1 ] ; then
F_PS_REVERSE_MODE=1
f_reverse_string "$F_PS_TARGET"
F_PS_TARGET="$F_REVERSE_STRING_R"
f_reverse_string "$F_PS_REPLACE"
F_PS_REPLACE="$F_REVERSE_STRING_R"
f_reverse_string "$F_PS_SOURCE"
F_PS_SOURCE="$F_REVERSE_STRING_R"
F_PS_NTH_OCCUR=$((-F_PS_NTH_OCCUR))
fi
f_power_sed_ecp "$F_PS_TARGET" 0
F_PS_TARGET=$F_POWER_SED_ECP_R
f_power_sed_ecp "$F_PS_REPLACE" 1
F_PS_REPLACE=$F_POWER_SED_ECP_R
local F_PS_SED_RPL=""
if [ ${F_PS_NTH_OCCUR} -eq -1 ] ; then
# NOTE: We kept this option because it performs better when we only need to replace
# the last occurrence. By Questor
# [Ref(s).: https://linuxhint.com/use-sed-replace-last-occurrence/ ,
# https://unix.stackexchange.com/a/713866/61742 ]
F_PS_SED_RPL="'s/\(.*\)$F_PS_TARGET/\1$F_PS_REPLACE/'"
elif [ ${F_PS_NTH_OCCUR} -gt 0 ] ; then
# [Ref(s).: https://unix.stackexchange.com/a/587924/61742 ]
F_PS_SED_RPL="'s/$F_PS_TARGET/$F_PS_REPLACE/$F_PS_NTH_OCCUR'"
elif [ ${F_PS_NTH_OCCUR} -eq 0 ] ; then
F_PS_SED_RPL="'s/$F_PS_TARGET/$F_PS_REPLACE/g'"
fi
# NOTE: As the "sed" commands below always process literal values for the "F_PS_TARGET"
# so we use the "-z" flag in case it has multiple lines. By Quaestor
# [Ref(s).: https://unix.stackexchange.com/a/525524/61742 ]
if [ -z "$F_PS_FILE" ] ; then
F_POWER_SED_R=$(echo "x${F_PS_SOURCE}x" | eval "sed -z $F_PS_SED_RPL")
F_POWER_SED_R=${F_POWER_SED_R%?}
F_POWER_SED_R=${F_POWER_SED_R#?}
if [ ${F_PS_REVERSE_MODE} -eq 1 ] ; then
f_reverse_string "$F_POWER_SED_R"
F_POWER_SED_R="$F_REVERSE_STRING_R"
fi
else
if [ ${F_PS_REVERSE_MODE} -eq 0 ] ; then
eval "sed -i -z $F_PS_SED_RPL \"$F_PS_FILE\""
else
tac "$F_PS_FILE" | rev | eval "sed -z $F_PS_SED_RPL" | tac | rev > "$F_PS_FILE"
fi
fi
}
MODEL
f_power_sed "F_PS_TARGET" "F_PS_REPLACE" "" "F_PS_SOURCE"
echo "$F_POWER_SED_R"
EXAMPLE
f_power_sed "{ gsub(/,[ ]+|$/,\"\0\"); print }' ./ and eliminate" "[ ]+|$/,\"\0\"" "" "Great answer (+1). If you change your awk to awk '{ gsub(/,[ ]+|$/,\"\0\"); print }' ./ and eliminate that concatenation of the final \", \" then you don't have to go through the gymnastics on eliminating the final record. So: readarray -td '' a < <(awk '{ gsub(/,[ ]+/,\"\0\"); print; }' <<<\"$string\") on Bash that supports readarray. Note your method is Bash 4.4+ I think because of the -d in readar"
echo "$F_POWER_SED_R"
IF YOU JUST WANT TO ESCAPE THE PARAMETERS TO THE SED COMMAND
MODEL
# "TARGET" value.
f_power_sed_ecp "F_PSE_VAL_TO_ECP" 0
echo "$F_POWER_SED_ECP_R"
# "REPLACE" value.
f_power_sed_ecp "F_PSE_VAL_TO_ECP" 1
echo "$F_POWER_SED_ECP_R"
IMPORTANT: If the strings for KEYWORD and/or replace REPLACE contain tabs or line breaks you will need to use the "-z" flag in your "sed" command. More details here.
EXAMPLE
f_power_sed_ecp "{ gsub(/,[ ]+|$/,\"\0\"); print }' ./ and eliminate" 0
echo "$F_POWER_SED_ECP_R"
f_power_sed_ecp "[ ]+|$/,\"\0\"" 1
echo "$F_POWER_SED_ECP_R"
NOTE: The f_power_sed_ecp and f_power_sed functions above was made available completely free as part of this project ez_i - Create shell script installers easily!.
Standard recommendation here: use perl :)
echo KEYWORD > /tmp/test
REPLACE="<funny characters here>"
perl -pi.bck -e "s/KEYWORD/${REPLACE}/g" /tmp/test
cat /tmp/test
don't forget all the pleasure that occur with the shell limitation around " and '
so (in ksh)
Var=">New version of \"content' here <"
printf "%s" "${Var}" | sed "s/[&\/\\\\*\\"']/\\&/g' | read -r EscVar
echo "Here is your \"text\" to change" | sed "s/text/${EscVar}/g"
If the case happens to be that you are generating a random password to pass to sed replace pattern, then you choose to be careful about which set of characters in the random string. If you choose a password made by encoding a value as base64, then there is is only character that is both possible in base64 and is also a special character in sed replace pattern. That character is "/", and is easily removed from the password you are generating:
# password 32 characters log, minus any copies of the "/" character.
pass=`openssl rand -base64 32 | sed -e 's/\///g'`;
If you are just looking to replace Variable value in sed command then just remove
Example:
sed -i 's/dev-/dev-$ENV/g' test to sed -i s/dev-/dev-$ENV/g test
I have an improvement over the sedeasy function, which WILL break with special characters like tab.
function sedeasy_improved {
sed -i "s/$(
echo "$1" | sed -e 's/\([[\/.*]\|\]\)/\\&/g'
| sed -e 's:\t:\\t:g'
)/$(
echo "$2" | sed -e 's/[\/&]/\\&/g'
| sed -e 's:\t:\\t:g'
)/g" "$3"
}
So, whats different? $1 and $2 wrapped in quotes to avoid shell expansions and preserve tabs or double spaces.
Additional piping | sed -e 's:\t:\\t:g' (I like : as token) which transforms a tab in \t.
An easier way to do this is simply building the string before hand and using it as a parameter for sed
rpstring="s/KEYWORD/$REPLACE/g"
sed -i $rpstring test.txt
I am trying to write a script which takes a directory containing text files (384 of them) and modifies duplicate lines that have a specific format in order to make them not duplicates.
In particular, I have files in which some lines begin with the '#' character and contain the substring 0:0. A subset of these lines are duplicated one or more times. For those that are duplicated, I'd like to replace 0:0 with i:0 where i starts at 1 and is incremented.
So far I've written a bash script that finds duplicated lines beginning with '#', writes them to a file, then reads them back and uses sed in a while loop to search and replace the first occurrence of the line to be replaced. This is it below:
#!/bin/bash
fdir=$1"*"
#for each fastq file
for f in $fdir
do
(
#find duplicated read names and write to file $f.txt
sort $f | uniq -d | grep ^# > "$f".txt
#loop over each duplicated readname
while read in; do
rname=$in
i=1
#while this readname still exists in the file increment and replace
while grep -q "$rname" $f; do
replace=${rname/0:0/$i:0}
sed -i.bu "0,/$rname/s/$rname/$replace/" "$f"
let "i+=1"
done
done < "$f".txt
rm "$f".txt
rm "$f".bu
done
echo "done" >> progress.txt
)&
background=( $(jobs -p) )
if (( ${#background[#]} ==40)); then
wait -n
fi
done
The problem with it is that its impractically slow. I ran it on a 48 core computer for over 3 days and it hardly got through 30 files. It also seemed to have removed about 10 files and I'm not sure why.
My question is where are the bugs coming from and how can I do this more efficiently? I'm open to using other programming languages or changing my approach.
EDIT
Strangely the loop works fine on one file. Basically I ran
sort $f | uniq -d | grep ^# > "$f".txt
while read in; do
rname=$in
i=1
while grep -q "$rname" $f; do
replace=${rname/0:0/$i:0}
sed -i.bu "0,/$rname/s/$rname/$replace/" "$f"
let "i+=1"
done
done < "$f".txt
To give you an idea of what the files look like below are a few lines from one of them. The thing is that even though it works for the one file, it's slow. Like multiple hours for one file of 7.5 M. I'm wondering if there's a more practical approach.
With regard to the file deletions and other bugs I have no idea what was happening Maybe it was running into memory collisions or something when they were run in parallel?
Sample input:
#D00269:138:HJG2TADXX:2:1101:0:0 1:N:0:CCTAGAAT+ATTCCTCT
GATAAGGACGGCTGGTCCCTGTGGTACTCAGAGTATCGCTTCCCTGAAGA
+
CCCFFFFFHHFHHIIJJJJIIIJJIJIJIJJIIBFHIHIIJJJJJJIJIG
#D00269:138:HJG2TADXX:2:1101:0:0 1:N:0:CCTAGAAT+ATTCCTCT
CAAGTCGAACGGTAACAGGAAGAAGCTTGCTTCTTTGCTGACGAGTGGCG
Sample output:
#D00269:138:HJG2TADXX:2:1101:1:0 1:N:0:CCTAGAAT+ATTCCTCT
GATAAGGACGGCTGGTCCCTGTGGTACTCAGAGTATCGCTTCCCTGAAGA
+
CCCFFFFFHHFHHIIJJJJIIIJJIJIJIJJIIBFHIHIIJJJJJJIJIG
#D00269:138:HJG2TADXX:2:1101:2:0 1:N:0:CCTAGAAT+ATTCCTCT
CAAGTCGAACGGTAACAGGAAGAAGCTTGCTTCTTTGCTGACGAGTGGCG
Here's some code that produces the required output from your sample input.
Again, it is assumed that your input file is sorted by the first value (up to the first space character).
time awk '{
#dbg if (dbg) print "#dbg:prev=" prev
if (/^#/ && prev!=$1) {fixNum=0 ;if (dbg) print "prev!=$1=" prev "!=" $1}
if (/^#/ && (prev==$1 || NR==1) ) {
prev=$1
n=split($1,tmpArr,":") ; n++
#dbg if (dbg) print "tmpArr[6]="tmpArr[6] "\tfixNum="fixNum
fixNum++;tmpArr[6]=fixNum;
# magic to rebuild $1 here
for (i=1;i<n;i++) {
tmpFix ? tmpFix=tmpFix":"tmpArr[i]"" : tmpFix=tmpArr[i]
}
$1=tmpFix ; $0=$0
print $0
}
else { tmpFix=""; print $0 }
}' file > fixedFile
output
#D00269:138:HJG2TADXX:2:1101:1:0 1:N:0:CCTAGAAT+ATTCCTCT
GATAAGGACGGCTGGTCCCTGTGGTACTCAGAGTATCGCTTCCCTGAAGA
+
CCCFFFFFHHFHHIIJJJJIIIJJIJIJIJJIIBFHIHIIJJJJJJIJIG
#D00269:138:HJG2TADXX:2:1101:2:0 1:N:0:CCTAGAAT+ATTCCTCT
CAAGTCGAACGGTAACAGGAAGAAGCTTGCTTCTTTGCTGACGAGTGGCG
I've left a few of the #dbg:... statements in place (but they are now commented out) to show how you can run a small set of data as you have provided, and watch the values of variables change.
Assuming a non-csh, you should be able to copy/paste the code block into a terminal window cmd-line and replace file > fixFile at the end with your real file name and a new name for the fixed file. Recall that awk 'program' file > file (actually, any ...file>file) will truncate the existing file and then try to write, SO you can lose all the data of a file trying to use the same name.
There are probably some syntax improvements that will reduce the size of this code, and there might be 1 or 2 things that could be done that will make the code faster, but this should run very quickly. If not, please post the result of time command that should appear at the end of the run, i.e.
real 0m0.18s
user 0m0.03s
sys 0m0.06s
IHTH
#!/bin/bash
i=4
sort $1 | uniq -d | grep ^# > dups.txt
while read in; do
if [ $((i%4))=0 ] && grep -q "$in" dups.txt; then
x="$in"
x=${x/"0:0 "/$i":0 "}
echo "$x" >> $1"fixed.txt"
else
echo "$in" >> $1"fixed.txt"
fi
let "i+=1"
done < $1
I want to read lines from a text file and save them in a variable.
cat ${1} | while read name; do
namelist=${name_list},${name}
done
the file looks like this:
David
Kevin
Steve
etc.
and i want to get this output instead
David, Kevin, Steve etc.
and save it to the variable ${name_list}
The command:
$ tr -s '\n ' ',' < sourcefile.txt # Replace newlines and spaces with [,]
This will likely return a , as the last character (and potentially the first).
To shave of the comma(s) and return a satisfying result:
$ name_list=$(tr -s '\n ' ',' < sourcefile.txt) # store the previous result
$ name_list=${tmp%,} # shave off the last comma
$ name_list=${tmp#,} # shave off any first comma
EDIT
This solution runs 44% faster and yields consistent and valid results across all Unix platforms.
# This solution
python -mtimeit -s 'import subprocess' "subprocess.call('tmp=$(tr -s "\n " "," < input.txt);echo ${tmp%,} >/dev/null',shell = True)"
100 loops, best of 3: 3.71 msec per loop
# Highest voted:
python -mtimeit -s 'import subprocess' "subprocess.call('column input.txt | sed "s/\t/,/g" >/dev/null',shell = True)"
100 loops, best of 3: 6.69 msec per loop
name_list=""
for name in `cat file.txt`
do VAR="$name_list,$i"
done
EDIT: this script leaves a "," at the beginning of name_list. There are a number of ways to fix this. For example, in bash this should work:
name_list=""
for name in `cat file.txt`; do
if [[ -z $name_list ]]; then
name_list="$i"
else
name_list="$name_list,$i"
fi
done
RE-EDIT: so, thanks to the legitimate complaints of Fredrik:
name_list=""
while read name
do
if [[ -z $name_list ]]; then
name_list="$name"
else
name_list="$name_list,$name"
fi
done < file.txt
Using column, and sed:
namelist=$(column input | sed 's/\t/,/g')
variable=`perl -lne 'next if(/^\s*$/);if($a){$a.=",$_"}else{$a=$_};END{print $a}' your_file`
I have small script in bash, which is generating graphs via gnuplot.
Everything works fine until names of input files contain space(s).
Here's what i've got:
INPUTFILES=("data1.txt" "data2 with spaces.txt" "data3.txt")
...
#MAXROWS is set earlier, not relevant.
for LINE in $( seq 0 $(( MAXROWS - 1 )) );do
gnuplot << EOF
reset
set terminal png
set output "out/graf_${LINE}.png"
filenames="${INPUTFILES[#]}"
set multiplot
plot for [file in filenames] file every ::0::${LINE} using 1:2 with line title "graf_${LINE}"
unset multiplot
EOF
done
This code works, but only without spaces in names of input files.
In the example gnuplot evaluate this:
1 iteration: file=data1.txt - CORRECT
2 iteration: file=data2 - INCORRECT
3 iteration: file=with - INCORRECT
4 iteration: file=spaces.txt - INCORRECT
The quick answer is that you can't do exactly what you want to do. Gnuplot splits the string in an iteration on spaces and there's no way around that (AFIK). Depending on what you want, there may be a "Work-around". You can write a (recursive) function in gnuplot to replace a character string with another --
#S,C & R stand for STRING, CHARS and REPLACEMENT to help this be a little more legible.
replace(S,C,R)=(strstrt(S,C)) ? \
replace( S[:strstrt(S,C)-1].R.S[strstrt(S,C)+strlen(C):] ,C,R) : S
Bonus points to anyone who can figure out how to do this without recursion...
Then your (bash) loop looks something like:
INPUTFILES_BEFORE=("data1.txt" "data2 with spaces.txt" "data3.txt")
INPUTFILES=()
#C style loop to avoid changing IFS -- Sorry SO doesn't like the #...
#This loop pre-processes files and changes spaces to '#_#'
for (( i=0; i < ${#INPUTFILES_BEFORE[#]}; i++)); do
FILE=${INPUTFILES_BEFORE[${i}]}
INPUTFILES+=( "`echo ${FILE} | sed -e 's/ /#_#/g'`" ) #replace ' ' with '#_#'
done
which preprocesses your input files to add '#_#' to the filenames which have spaces in them... Finally, the "complete" script:
...
INPUTFILES_BEFORE=("data1.txt" "data2 with spaces.txt" "data3.txt")
INPUTFILES=()
for (( i=0; i < ${#INPUTFILES_BEFORE[#]}; i++)); do
FILE=${INPUTFILES_BEFORE[${i}]}
INPUTFILES+=( "`echo ${FILE} | sed -e 's/ /#_#/g'`" ) #replace ' ' with '#_#'
done
for LINE in $( seq 0 $(( MAXROWS - 1 )) );do
gnuplot <<EOF
filenames="${INPUTFILES[#]}"
replace(S,C,R)=(strstrt(S,C)) ? \
replace( S[:strstrt(S,C)-1].R.S[strstrt(S,C)+strlen(C):] , C ,R) : S
#replace '#_#' with ' ' in filenames.
plot for [file in filenames] replace(file,'#_#',' ') every ::0::${LINE} using 1:2 with line title "graf_${LINE}"
EOF
done
However, I think the take-away here is that you shouldn't use spaces in filenames ;)
Escape the spaces:
"data2\ with\ spaces.txt"
EDIT
It seems that even with escape sequences, as you have mentioned, the bash for will always parse the input on the spaces.
Can you convert your script to work in a while loop fashion:
http://ubuntuforums.org/showthread.php?t=83424
This also may be a solution, but it's new to me and I'm still playing with it to understand exactly what it's doing:
http://www.cyberciti.biz/tips/handling-filenames-with-spaces-in-bash.html