I have a file contains some lines. Now I want to read the lines and get the line numbers. As below:
while read line
do
string=$line
number=`awk '{print NR}'` # This way is not right, gets all the line numbers.
done
Here is my scenario: I have one file, contains some lines, such as below:
2015Y7M3D0H0Mi44S7941
2015Y7M3D22H24Mi3S7927
2015Y7M3D21H28Mi21S5001
I want to read each line of this file, print out the last characters starts with "S" and the line number of it. it shoud looks like:
1 S7941
2 S7927
3 S5001
So, what should I properly do to get this?
Thanks.
Can anyone help me out ???
The UNIX shell is simply an environment from which to call tools and a language to sequence those calls. The UNIX general purpose text processing tool is awk so just use it:
$ awk '{sub(/.*S/,NR" S")}1' file
1 S7941
2 S7927
3 S5001
If you're going to be doing any text manipulation, get the book Effective Awk Programming, 4th Edition, by Arnold Robbins.
I just asked one of my friend, Found a simple way:
cat -n $file |while read line
do
number=echo $line | cut -d " " -f 1
echo $number
done
That means if we can not get line number from the file itself, we pass it with a line number.
Related
I have a file with 2 columns, and i want to use the values from the second column to set the range in the cut command to select a range of characters from another file. The range i desire is the character in the position of the value in the second column plus the next 10 characters. I will give an example in a while.
My files are something like that:
File with 2 columns and no blank lines between lines (file1.txt):
NAME1 10
NAME2 25
NAME3 48
NAME4 66
File that i want to extract the variable range of characters(just one very long line with no spaces and no bold font) (file2.txt):
GATCGAGCGGGATTCTTTTTTTTTAGGCGAGTCAGCTAGCATCAGCTACGAGAGGCGAGGGCGGGCTATCACGACTACGACTACGACTACAGCATCAGCATCAGCGCACTAGAGCGAGGCTAGCTAGCTACGACTACGATCAGCATCGCACATCGACTACGATCAGCATCAGCTACGCATCGAAGAGAGAGC
...or, more literally (for copy/paste to test):
GATCGAGCGGGATTCTTTTTTTTTAGGCGAGTCAGCTAGCATCAGCTACGAGAGGCGAGGGCGGGCTATCACGACTACGACTACGACTACAGCATCAGCATCAGCGCACTAGAGCGAGGCTAGCTAGCTACGACTACGATCAGCATCGCACATCGACTACGATCAGCATCAGCTACGCATCGAAGAGAGAGC
Desired resulting file, one sequence per line (result.txt):
GATTCTTTTT
GGCGAGTCAG
CGAGAGGCGA
TATCACGACT
The resulting file would have the characters from 10-20, 25-35, 48-58 and 66-76, each range in a new line. So, it would always keep the range of 10, but in different start points and those start points are set by the values in the second column from the first file.
I tried the command:
for i in $(awk '{print $2}' file1.txt);
do
p1=$i;
p2=`expr "$1" + 10`
cut -c$p1-$2 file2.txt > result.txt;
done
I don't get any output or error message.
I also tried:
while read line; do
set $line
p2=`expr "$2" + 10`
cut -c$2-$p2 file2.txt > result.txt;
done <file1.txt
This last command gives me an error message:
cut: invalid range with no endpoint: -
Try 'cut --help' for more information.
expr: non-integer argument
There's no need for cut here; dd can do the job of indexing into a file, and reading only the number of bytes you want. (Note that status=none is a GNUism; you may need to leave it out on other platforms and redirect stderr otherwise if you want to suppress informational logging).
while read -r name index _; do
dd if=file2.txt bs=1 skip="$index" count=10 status=none
printf '\n'
done <file1.txt >result.txt
This approach avoids excessive memory requirements (as present when reading the whole of file2 -- assuming it's large), and has bounded performance requirements (overhead is equal to starting one copy of dd per sequence to extract).
Using awk
$ awk 'FNR==NR{a=$0; next} {print substr(a,$2+1,10)}' file2 file1
GATTCTTTTT
GGCGAGTCAG
CGAGAGGCGA
TATCACGACT
If file2.txt is not too large, then you can read it in memory,
and use Bash sub-strings to extract the desired ranges:
data=$(<file2.txt)
while read -r name index _; do
echo "${data:$index:10}"
done <file1.txt >result.txt
This will be much more efficient than running cut or another process for every single range definition.
(Thanks to #CharlesDuffy for the tip to read data without a useless cat, and the while loop.)
One way to solve it:
#!/bin/bash
while read line; do
pos=$(echo "$line" | cut -f2 -d' ')
x=$(head -c $(( $pos + 10 )) file2.txt | tail -c 10)
echo "$x"
done < file1.txt > result.txt
It's not the solution an experienced bash hacker would use, but it is very good for someone who is new to bash. It uses tools that are very versatile, although somewhat bad if you need high performance. Shell scripting is commonly used by people who rarely shell scripts, but knows a few commands and just wants to get the job done. That's why I'm including this solution, even if the other answers are superior for more experienced people.
The first line is pretty easy. It just extracts the numbers from file1.txt. The second line uses the very nice tools head and tail. Usually, they are used with lines instead of characters. Nevertheless, I print the first pos + 10 characters with head. The result is piped into tail which prints the last 10 characters.
Thanks to #CharlesDuffy for improvements.
I want to replace the first value (in first column and line so here 1) and add one to this value, so I have a file like this
1
1 1
2 5
1 6
I use this sentence
read -r a < file
echo $aa
sed "s/$aa/$(($aa + 1))/" file
# or
sed 's/$aa/$(($aa + 1))/' file
But when I make that, he change all first column one into two. I have try to change the quote but it make nothing.
restrict the script to first line only, i.e.
sed '1s/old/new/'
awk might be a better tool for this.
awk 'NR==1{$1=$1+1}1'
for the first line add 1 to the first field and print. Can be rewritten as
awk 'NR==1{$1+=1}1'
or
awk 'NR==1{$1++}1'
perl -p0e 's/(\d+)/$1+1/e' file
Okay so Ive compile this code to read a text file however it succesfully finds the sum of every column needed except from the first line! Hence gives me the wrong summation which excludes the value on the first line it reads in. It sets value: $line = ddsdfj:jdskf:1:fjf but never extracts the 1 from the first line. Any clues would be appreciated.
FILE=$1
while read line
do
awk -F: '{summation += $3;}END{print summation;}'
done < $FILE
The while loop is completely superfluous. It looks like what you want is
awk -F: '{s+=$3}END{print s}' "$1"
quite simply.
The code you had would read the first line with read, then the other lines as standard input to awk; hence, the behavior you were observing. Something like
while read line; do
awk -F: '{s+=$3}END{print s}' <<<"$line"
done <"$1"
would have actually used the value from line for something, but of course, that would just extract the third field from each line individually, not performed any actual addition of values from different lines.
This question already has answers here:
How to get the part of a file after the first line that matches a regular expression
(12 answers)
Closed 7 years ago.
I have a file that contains a list of URLs. It looks like below:
file1:
http://www.google.com
http://www.bing.com
http://www.yahoo.com
http://www.baidu.com
http://www.yandex.com
....
I want to get all the records after: http://www.yahoo.com, results looks like below:
file2:
http://www.baidu.com
http://www.yandex.com
....
I know that I could use grep to find the line number of where yahoo.com lies using
grep -n 'http://www.yahoo.com' file1
3 http://www.yahoo.com
But I don't know how to get the file after line number 3. Also, I know there is a flag in grep -A print the lines after your match. However, you need to specify how many lines you want after the match. I am wondering is there something to get around that issue. Like:
Pseudocode:
grep -n 'http://www.yahoo.com' -A all file1 > file2
I know we could use the line number I got and wc -l to get the number of lines after yahoo.com, however... it feels pretty lame.
AWK
If you don't mind using AWK:
awk '/yahoo/{y=1;next}y' data.txt
This script has two parts:
/yahoo/ { y = 1; next }
y
The first part states that if we encounter a line with yahoo, we set the variable y=1, and then skip that line (the next command will jump to the next line, thus skip any further processing on the current line). Without the next command, the line yahoo will be printed.
The second part is a short hand for:
y != 0 { print }
Which means, for each line, if variable y is non-zero, we print that line. In AWK, if you refer to a variable, that variable will be created and is either zero or empty string, depending on context. Before encounter yahoo, variable y is 0, so the script does not print anything. After encounter yahoo, y is 1, so every line after that will be printed.
Sed
Or, using sed, the following will delete everything up to and including the line with yahoo:
sed '1,/yahoo/d' data.txt
This is much easier done with sed than grep. sed can apply any of its one-letter commands to an inclusive range of lines; the general syntax for this is
START , STOP COMMAND
except without any spaces. START and STOP can each be a number (meaning "line number N", starting from 1); a dollar sign (meaning "the end of the file"), or a regexp enclosed in slashes, meaning "the first line that matches this regexp". (The exact rules are slightly more complicated; the GNU sed manual has more detail.)
So, you can do what you want like so:
sed -n -e '/http:\/\/www\.yahoo\.com/,$p' file1 > file2
The -n means "don't print anything unless specifically told to", and the -e directive means "from the first appearance of a line that matches the regexp /http:\/\/www\.yahoo\.com/ to the end of the file, print."
This will include the line with http://www.yahoo.com/ on it in the output. If you want everything after that point but not that line itself, the easiest way to do that is to invert the operation:
sed -e '1,/http:\/\/www\.yahoo\.com/d' file1 > file2
which means "for line 1 through the first line matching the regexp /http:\/\/www\.yahoo\.com/, delete the line" (and then, implicitly, print everything else; note that -n is not used this time).
awk '/yahoo/ ? c++ : c' file1
Or golfed
awk '/yahoo/?c++:c' file1
Result
http://www.baidu.com
http://www.yandex.com
This is most easily done in Perl:
perl -ne 'print unless 1 .. m(http://www\.yahoo\.com)' file
In other words, print all lines that aren’t between line 1 and the first occurrence of that pattern.
Using this script:
# Get index of the "yahoo" word
index=`grep -n "yahoo" filepath | cut -d':' -f1`
# Get the total number of lines in the file
totallines=`wc -l filepath | cut -d' ' -f1`
# Subtract totallines with index
result=`expr $total - $index`
# Gives the desired output
grep -A $result "yahoo" filepath
I've a text file with 2 million lines. Each line has some transaction information.
e.g.
23848923748, sample text, feild2 , 12/12/2008
etc
What I want to do is create a new file from a certain unique transaction number onwards. So I want to split the file at the line where this number exists.
How can I do this form the command line?
I can find the line by doing this:
cat myfile.txt | grep 23423423423
use sed like this
sed '/23423423423/,$!d' myfile.txt
Just confirm that the unique transaction number cannot appear as a pattern in some other part of the line (especially, before the correctly matching line) in your file.
There is already a 'perl' answer here, so, i'll give one more AWK way :-)
awk '{BEGIN{skip=1} /number/ {skip=0} // {if (skip!=1) print $0}' myfile.txt
On a random file in my tmp directory, this is how I output everything from the line matching popd onwards in a file named tmp.sh:
tail -n+`grep -n popd tmp.sh | cut -f 1 -d:` tmp.sh
tail -n+X matches from that line number onwards; grep -n outputs lineno:filename, and cut extracts just lineno from grep.
So for your case it would be:
tail -n+`grep -n 23423423423 myfile.txt | cut -f 1 -d:` myfile.txt
And it should indeed match from the first occurrence onwards.
It's not a pretty solution, but how about using -A parameter of grep?
Like this:
mc#zolty:/tmp$ cat a
1
2
3
4
5
6
7
mc#zolty:/tmp$ cat a | grep 3 -A1000000
3
4
5
6
7
The only problem I see in this solution is the 1000000 magic number. Probably someone will know the answer without using such a trick.
You can probably get the line number using Grep and then use Tail to print the file from that point into your output file.
Sorry I don't have actual code to show, but hopefully the idea is clear.
I would write a quick Perl script, frankly. It's invaluable for anything like this (relatively simple issues) and as soon as something more complex rears its head (as it will do!) then you'll need the extra power.
Something like:
#!/bin/perl
my $out = 0;
while (<STDIN>) {
if /23423423423/ then $out = 1;
print $_ if $out;
}
and run it using:
$ perl mysplit.pl < input > output
Not tested, I'm afraid.