I am trying to copy about 100 CSVs into a PostgreSQL database. The CSVs aren't formed perfectly for the database, so I have to do some editing, which I am trying to do on the fly with piping.
Because each CSV file has a header, I need to remove the first line to prevent the headers from being copied into the database as an entity.
My attempt at this was the following:
sed -e "s:\.00::g" -e "s/\"\"//g" *.csv | tail -n +2 | cut -d "," -f1-109 |
psql -d intelliflight_pg -U intelliflight -c "\COPY flights FROM stdin WITH DELIMITER ',' CSV"
The problem I'm having with this is that it treats *.csv as a single file, and only removes the first line of the first file it sees, and leaves the rest of the files alone.
How can I get this to remove the first line of each individual file retrieved by the *.csv wildcard?
You can combine the sed and tail steps and use find to have per-file processing, then pipe the output of that to cut and psql:
find -name '*.csv' -exec sed '1d;s/\.00//g;s/""//g' {} \; | cut ...
This uses sed to remove the first line from each file, then does the substitutions on the rest of the files. Each file is processed, and the output of it all piped to cut and the rest of your commands.
Notice the single quotes around the sed argument, simplifying things somewhat with the quoting.
This also processes .csv files in subdirectories; if you don't want that, you have to limit recursion depth with
find -maxdepth 1 -name etc.
Can't test it right now but this should do :
awk -F, '
FNR == 1 {next}
{
gsub(/\.00/, "")
gsub(/""/, "")
NF = 109
print
}
' *.csv | psql ..
The NF= 109 line will drop any field after 109.
Related
I run the following gsutil command:
gsutil ls -d gs://mybucket/v${version}/folder1/*/*.whl |
sort -V |
grep -e "/*.whl"
I get:
gs://mybucket/v1.0.0/folder1/1560924028/file1-cp27-cp27mu-linux_x86_64.whl
gs://mybucket/v1.0.0/folder1/1560926922/file1-cp36-cp36m-linux_x86_64.whl
gs://mybucket/v1.0.0/folder1/1560930522/file1-cp35-cp35m-linux_x86_64.whl
gs://mybucket/v1.0.0/folder1/1561568612/file1-cp37-cp37m-linux_x86_64.whl
gs://mybucket/v1.0.0/folder1/1561595893/file1-cp37-cp37m-linux_x86_64.whl
gs://mybucket/v1.0.0/folder1/1561654308/file1-cp37-cp37m-linux_x86_64.whl
gs://mybucket/v1.0.0/folder1/1563319372/file1-cp27-cp27mu-linux_x86_64.whl
gs://mybucket/v1.0.0/folder1/1563319400/file1-cp36-cp36m-linux_x86_64.whl
gs://mybucket/v1.0.0/folder1/1563329633/file1-cp27-cp27mu-linux_x86_64.whl
gs://mybucket/v1.0.0/folder1/1563411368/file1-cp35-cp35m-linux_x86_64.whl
gs://mybucket/v1.0.0/folder1/1565916833/file1-cp27-cp27mu-linux_x86_64.whl
gs://mybucket/v1.0.0/folder1/1565921265/file1-cp35-cp35m-linux_x86_64.whl
gs://mybucket/v1.0.0/folder1/1566258114/file1-cp27-cp27mu-linux_x86_64.whl
Since some files in different folders have the same names, how can I retrieve unique filenames ignoring the path?
I would do it like this:
blabla_your_command | rev | sort -t'/' -u -k1,1 | rev
rev reverses lines. Then I unique sort using / as a separator on the first field. After the line is reversed, the first field will be the filename, so sorting -u on it would return only unique filenames. Then the line needs to be reversed back.
The following command:
cat <<EOF |
gs://mybucket/v1.0.0/folder1/1560924028/file1-cp27-cp27mu-linux_x86_64.whl
gs://mybucket/v1.0.0/folder1/1560926922/file1-cp36-cp36m-linux_x86_64.whl
gs://mybucket/v1.0.0/folder1/1560930522/file1-cp35-cp35m-linux_x86_64.whl
gs://mybucket/v1.0.0/folder1/1561568612/file1-cp37-cp37m-linux_x86_64.whl
gs://mybucket/v1.0.0/folder1/1561595893/file1-cp37-cp37m-linux_x86_64.whl
gs://mybucket/v1.0.0/folder1/1561654308/file1-cp37-cp37m-linux_x86_64.whl
gs://mybucket/v1.0.0/folder1/1563319372/file1-cp27-cp27mu-linux_x86_64.whl
gs://mybucket/v1.0.0/folder1/1563319400/file1-cp36-cp36m-linux_x86_64.whl
gs://mybucket/v1.0.0/folder1/1563329633/file1-cp27-cp27mu-linux_x86_64.whl
gs://mybucket/v1.0.0/folder1/1563411368/file1-cp35-cp35m-linux_x86_64.whl
gs://mybucket/v1.0.0/folder1/1565916833/file1-cp27-cp27mu-linux_x86_64.whl
gs://mybucket/v1.0.0/folder1/1565921265/file1-cp35-cp35m-linux_x86_64.whl
gs://mybucket/v1.0.0/folder1/1566258114/file1-cp27-cp27mu-linux_x86_64.whl
EOF
rev | sort -t'/' -u -k1,1 | rev
outputs:
gs://mybucket/v1.0.0/folder1/1560930522/file1-cp35-cp35m-linux_x86_64.whl
gs://mybucket/v1.0.0/folder1/1560926922/file1-cp36-cp36m-linux_x86_64.whl
gs://mybucket/v1.0.0/folder1/1561568612/file1-cp37-cp37m-linux_x86_64.whl
gs://mybucket/v1.0.0/folder1/1560924028/file1-cp27-cp27mu-linux_x86_64.whl
Please check awk option given below, this will print the last occurrence of delimiter '/', it worked for me
example:
gsutil ls gs://mybucket/v1.0.0/folder1/1560930522 | awk -F/ '{print $(NF)}'
print all the file names under '1560930522'
your_command|awk -F/ '!($NF in a){a[$NF]; print}'
gs://mybucket/v1.0.0/folder1/1560924028/file1-cp27-cp27mu-linux_x86_64.whl
gs://mybucket/v1.0.0/folder1/1560926922/file1-cp36-cp36m-linux_x86_64.whl
gs://mybucket/v1.0.0/folder1/1560930522/file1-cp35-cp35m-linux_x86_64.whl
gs://mybucket/v1.0.0/folder1/1561568612/file1-cp37-cp37m-linux_x86_64.whl
4 different ways of saying the same thing
nawk -F'^.+/' '++_[$NF]<NF'
gawk -F'/' '__[$NF]++<!_'
mawk -F/ '_^__[$NF]++'
mawk2 -F/ '!_[$NF]--'
gs://mybucket/v1.0.0/folder1/1560924028/file1-cp27-cp27mu-linux_x86_64.whl
gs://mybucket/v1.0.0/folder1/1560926922/file1-cp36-cp36m-linux_x86_64.whl
gs://mybucket/v1.0.0/folder1/1560930522/file1-cp35-cp35m-linux_x86_64.whl
gs://mybucket/v1.0.0/folder1/1561568612/file1-cp37-cp37m-linux_x86_64.whl
Here's a simple, straightforward solution:
$ your_gsutil_command | xargs -L 1 basename | sort -u
The easiest way to remove paths is with basename. Unfortunately it accepts only a single filename, which must be on the command line (not from stdin), so we need to take the following steps:
Create the list of files.
We do this with your_gsutil_command, but you can use any command that generates a list of files.
Send each one to basename to remove its path.
The xargs command does this for us by reading its stdin and invoking basename repeatedly, passing the data as command-line arguments. But xargs efficiently tries to reduce the number of invocations by passing multiple filenames on each command line, and that breaks basename. We prevent that with -L 1, limiting it to only one line (that is, one filename) at a time.
Remove duplicates.
The sort -u command does this.
Using your example data:
$ gsutil ls -d gs://mybucket/v${version}/folder1/*/*.whl |
xargs -L 1 basename | sort -u
file1-cp27-cp27mu-linux_x86_64.whl
file1-cp35-cp35m-linux_x86_64.whl
file1-cp36-cp36m-linux_x86_64.whl
file1-cp37-cp37m-linux_x86_64.whl
Caveat: Spaces break everything. 😡
So far we've assumed the filenames and folders do not contain spaces. Spaces break basename because needs exactly one filename, and it would interpret spaces as separators between multiple filenames. We can get around this in two ways:
ls -Q: If you're deduplicating local filenames, you can use the (non-gsutil) ls command with the -Q flag to put the filenames in quotes, so basename will interpret spaces as part of the filenames rather than separators.
gsutil: The -Q flag is unfortunately not supported, so we'll need to escape the spaces manually:
$ your_gsutil_command | sed 's/ /\\ /g' | xargs -L 1 basename | sort -u
Here we use the sed command to escape each space by inserting a backslash before it. (That is, we replace with \ . Note that we also need to escape the backslash in the sed command, which is why we use \\ and not just \.)
I've search lots of questions on here and other sites, and people have suggested things that should fix my problem, but I think there's something wrong with my code that I just don't recognize.
I have 24 .fasta files from NGS sequencing that are 150bp long. There's approximately 1M reads for each file. The reads are from targeted sequencing where we electroplated vectors with cDNA for genes of interest, and a unique barcode sequence. I need to look through the sequencing files for the presence or absence of the barcode sequence which corresponds to a specific gene.
I have a .txt list of the barcodeSequences that I want to pass to grep to look for the barcode in the .fasta file. I've tried so many variations of this command. I can give grep each barcode individually but that's so time consuming, I know it's possible to give it the list of barcode sequences and search each .fasta for each of the barcodes and record how many times each barcode is found in each file.
Here's my code where I give it each barcode individually:
# Barcode 33
mkdir --mode 755 $dir/BC33
FILES="*.fasta"
for f in $FILES; do
cat "$f" | tr -d "\n" | tr ">" "\n" | grep 'TATTAGAGTTTGAGAATAAGTAGT' > $dir/BC33/"$f"
done
I tried to adapt it so that I don't have to feed every barcode sequence in individually:
dir="/home/lozzib/AG_Barcode_Seq/"
cd $dir
FILES="*.fasta"
for f in $FILES; do
cat "$f" | tr -d "\n" | tr ">" "\n" | grep -c -f BarcodeScreenSeq.txt | sort > $dir/Results/"$f"
echo "Finished $f"
done
But it is not searching for the barcode sequences. With this iteration it is just returning new files in the /Results directory that are empty. I also tried a nest loop, where I tried to make the barcode sequence a variable that changed like the $FILES, but that just gave me a new file with the names of my .fasta files:
dir="/home/lozzib/AG_Barcode_Seq/"
cd $dir
FILES="*.fasta"
for f in $FILES; do
for b in `cat /home/lozzib/AG_Barcode_Seq/BarcodeScreenSeq.txt`; do
cat "$f" | grep -c "$b" | sort > $dir/"$f"_Barcode
done ;
done
I want a output .txt file that has:
<barcode sequence>: <# of times that bc was found>
for each .fasta file because I want to put all the samples together to make one large excel sheet which shows each barcode and how many times it was found in each sample.
Please help, I've tried everything I can think of.
EDIT
Here is what the BarcodeScreenSeq.txt file would look like. It's just a txt file where each line is a barcode sequence:
head BarcodeScreenSeq.txt
TATTATGAGAAAGTTGAATAGTAG
ATGAAAGTTAGAGTTTATGATAAG
AATAGATAAGATTGATTGTGTTTG
TGTTAAATGTATGTAGTAATTGAG
ATAGATTTAAGTGAAGAGAGTTAT
GAATGTTTGTAAATGTATAGATAG
AAATTGTGAAAGATTGTTTGTGTA
TGTAAGTGAAATAGTGAGTTATTT
GAATTGTATAAAGTATTAGATGTG
AGTGAGATTATGAGTATTGATTTA
EDIT
lozzib#gliaserver:~/AG_Barcode_Seq$ file BarcodeScreenSeq.txt
BarcodeScreenSeq.txt: ASCII text, with CRLF line terminators
Windows Line Endings
Your BarcodeScreenSeq.txt has windows line endings. Each line ends with the special characters \r\n. Linux tools such as grep only deal with linux line endings \r and interpret your file ...
TATTATG\r\n
ATGAAAG\r\n
...
to look for the patterns TATTATG\r, ATGAAAG\r, ... (note the \r at the end). Because of the \r there is no match.
Either: Convert your file once bye running dos2unix BarcodeScreenSeq.txt or sed -i 's/\r//g' BarcodeScreenSeq.txt. This will change your file.
Or: replace every BarcodeScreenSeq.txt in the following scripts by <(tr -d '\r' < BarcodeScreenSeq.txt). This won't change the file, but creates more overhead as the file is converted over and over again.
Command
grep -c has only one counter. If you pass multiple search patterns at once (for instance using -f BarcodeScreenSeq.txt) you still get only one number for all patterns together.
To count the occurrences of each pattern individually you can use the following trick:
for file in *.fasta; do
grep -oFf BarcodeScreenSeq.txt "$file" |
sort | uniq -c |
awk '{print $2 ": " $1 }' > "Results/$file"
done
grep -o will print each match as a single line.
sort | uniq -c will count how often each line occurs.
awk is only there to change the format from #matches pattern to pattern: #matches.
Benefit: The command should be fairly fast.
Drawback: Patterns from BarcodeScreenSeq.txt that are not found in $file won't be listed at all. Your result will leave out lines of the form pattern: 0.
If you really need the lines of the form pattern: 0 you could use another trick:
for file in *.fasta; do
grep -oFf BarcodeScreenSeq.txt "$file" |
cat - BarcodeScreenSeq.txt |
sort | uniq -c |
awk '{print $2 ": " ($1 - 1) }' > "Results/$file"
done
cat - BarcodeScreenSeq.txt will insert the content of BarcodeScreenSeq.txt at the end of grep's output such that #matches is one bigger than it should be. The number is corrected by awk.
You can read a text file one line at a time and process each line separately using a redirect, like so:
for f in *.fasta; do
while read -r seq; do
grep -c "${seq}" "${f}" > "${dir}"/"${f}"_Barcode
done < /home/lozzib/AG_Barcode_Seq/BarcodeScreenSeq.txt
done
I need to write a Bash script that achieve the following goals:
1) move the newest n pdf files from folder 1 to folder 2;
2) correctly handles files that could have spaces in file names;
3) output each file name in a specific position in a text file. (In my actual usage, I will use sed to put the file names in a specific position of an existing file.)
I tried to make an array of filenames and then move them and do text output in a loop. However, the following array cannot handle files with spaces in filename:
pdfs=($(find -name "$DOWNLOADS/*.pdf" -print0 | xargs -0 ls -1 -t | head -n$NUM))
Suppose a file has name "Filename with Space". What I get from the above array will have "with" and "Space" in separate array entries.
I am not sure how to avoid these words in the same filename being treated separately.
Can someone help me out?
Thanks!
-------------Update------------
Sorry for being vague on the third point as I thought I might be able to figure that out after achieving the first and second goals.
Basically, it is a text file that have a line start with "%comment" near the end and I will need to insert the filenames before that line in the format "file=PATH".
The PATH is the folder 2 that I have my pdfs moved to.
You can achieve this using mapfile in conjunction with gnu versions of find | sort | cut | head that have options to operate on NUL terminated filenames:
mapfile -d '' -t pdfs < <(find "$DOWNLOADS/*.pdf" -name 'file*' -printf '%T#:%p\0' |
sort -z -t : -rnk1 | cut -z -d : -f2- | head -z -n $NUM)
Commands used are:
mapfile -d '': To read array with NUL as delimiter
find: outputs each file's modification stamp in EPOCH + ":" + filename + NUL byte
sort: sorts reverse numerically on 1st field
cut: removes 1st field from output
head: outputs only first $NUM filenames
find downloads -name "*.pdf" -printf "%T# %p\0" |
sort -z -t' ' -k1 -n |
cut -z -d' ' -f2- |
tail -z -n 3
find all *.pdf files in downloads
for each file print it's modifition date %T with the format specifier # that means seconds since epoch with fractional part, then print space, filename and separate with \0
Sort the null separated stream using space as field separator using only first field using numerical sort
Remove the first field from the stream, ie. creation date, leaving only filenames.
Get the count of the newest files, in this example 3 newest files, by using tail. We could also do reverse sort and use head, no difference.
Don't use ls in scripts. ls is for nice formatted output. You could do xargs -0 stat --printf "%Y %n\0" which would basically move your script forward, as ls isn't meant to be used for scripts. Just that I couldn't make stat output fractional part of creation date.
As for the second part, we need to save the null delimetered list to a file
find downloads ........ >"$tmp"
and then:
str='%comment'
{
grep -B$((2**32)) -x "$str" "$out" | grep -v "$str"
# I don't know what you expect to do with newlines in filenames, but I guess you don't have those
cat "$tmp" | sed -z 's/^/file=/' | sed 's/\x0/\n/g'
grep -A$((2**32)) -x "$str" "$out"
} | sponge "$out"
where output is the output file name
assuming output file name is stored in variable "$out"
filter all lines before the %comment and remove the line %comment itself from the file
output each filename with file= on the beginning. I also substituted zeros for newlines.
the filter all lines after %comment including %comment itself
write the output for outfile. Remember to use a temporary file.
Don't use pdf=$(...) on null separated inputs. You can use mapfile to store that to an array, as other answers provided.
Then to move the files, do smth like
<"$tmp" xargs -0 -i mv {} "$outdir"
or faster, with a single move:
{ cat <"$tmp"; printf "%s\0" "$outdir"; } | xargs -0 mv
or alternatively:
<"$tmp" xargs -0 sh -c 'outdir="$1"; shift; mv "$#" "$outdir"' -- "$outdir"
Live example at turorialspoint.
I suppose following code will be close to what you want:
IFS=$'\n' pdfs=($(find -name "$DOWNLOADS/*.pdf" -print0 | xargs -0 -I ls -lt "{}" | tail -n +1 | head -n$NUM))
Then you can access the output through ${pdfs[0]}, ${pdfs[1]}, ...
Explanations
IFS=$'\n' makes the following line to be split only with "\n".
-I option for xargs tells xargs to substitute {} with filenames so it can be quoted as "{}".
tail -n +1 is a trick to suppress an error message saying "xargs: 'ls' terminated by signal 13".
Hope this helps.
Bash v4 has an option globstar, after enabling this option, we can use ** to match zero or more subdirectories.
mapfile is a built-in command, which is used for reading lines into an indexed array variable. -t option removes a trailing newline.
shopt -s globstar
mapfile -t pdffiles < <(ls -t1 **/*.pdf | head -n"$NUM")
typeset -p pdffiles
for f in "${pdffiles[#]}"; do
echo "==="
mv "${f}" /dest/path
sed "/^%comment/i${f}=/dest/path" a-text-file.txt
done
I am interested in concatenate many files together based on the numeric number and also remove the first line.
e.g. chr1_smallfiles then chr2_smallfiles then chr3_smallfiles.... etc (each without the header)
Note that chr10_smallfiles needs to come after chr9_smallfiles -- that is, this needs to be numeric sort order.
When separate the two command awk and ls -v1, each does the job properly, but when put them together, it doesn't work. Please help thanks!
awk 'FNR>1' | ls -v1 chr*_smallfiles > bigfile
The issue is with the way that you're trying to pass the list of files to awk. At the moment, you're piping the output of awk to ls, which makes no sense.
Bear in mind that, as mentioned in the comments, ls is a tool for interactive use, and in general its output shouldn't be parsed.
If sorting weren't an issue, you could just use:
awk 'FNR > 1' chr*_smallfiles > bigfile
The shell will expand the glob chr*_smallfiles into a list of files, which are passed as arguments to awk. For each filename argument, all but the first line will be printed.
Since you want to sort the files, things aren't quite so simple. If you're sure the full range of files exist, just replace chr*_smallfiles with chr{1..99}_smallfiles in the original command.
Using some Bash-specific and GNU sort features, you can also achieve the sorting like this:
printf '%s\0' chr*_smallfiles | sort -z -n -k1.4 | xargs -0 awk 'FNR > 1' > bigfile
printf '%s\0' prints each filename followed by a null-byte
sort -z sorts records separated by null-bytes
-n -k1.4 does a numeric sort, starting from the 4th character (the numeric part of the filename)
xargs -0 passes the sorted, null-separated output as arguments to awk
Otherwise, if you want to go through the files in numerical order, and you're not sure whether all the files exist, then you can use a shell loop (although it'll be significantly slower than a single awk invocation):
for file in chr{1..99}_smallfiles; do # 99 is the maximum file number
[ -f "$file" ] || continue # skip missing files
awk 'FNR > 1' "$file"
done > bigfile
You can also use tail to concatenate all the files without header
tail -q -n+2 chr*_smallfiles > bigfile
In case you want to concatenate the files in a natural sort order as described in your quesition, you can pipe the result of ls -v1 to xargs using
ls -v1 chr*_smallfiles | xargs -d $'\n' tail -q -n+2 > bigfile
(Thanks to Charles Duffy) xargs -d $'\n' sets the delimiter to a newline \n in case the filename contains white spaces or quote characters
Using a bash 4 associative array to extract only the numeric substring of each filename; sort those individually; and then retrieve and concatenate the full names in the resulting order:
#!/usr/bin/env bash
case $BASH_VERSION in ''|[123].*) echo "Requires bash 4.0 or newer" >&2; exit 1;; esac
# when this is done, you'll have something like:
# files=( [1]=chr_smallfiles1.txt
# [10]=chr_smallfiles10.txt
# [9]=chr_smallfiles9.txt )
declare -A files=( )
for f in chr*_smallfiles.txt; do
files[${f//[![:digit:]]/}]=$f
done
# now, emit those indexes (1, 10, 9) to "sort -n -z" to sort them as numbers
# then read those numbers, look up the filenames associated, and pass to awk.
while read -r -d '' key; do
awk 'FNR > 1' <"${files[$key]}"
done < <(printf '%s\0' "${!files[#]}" | sort -n -z) >bigfile
You can do with a for loop like below, which is working for me:-
for file in chr*_smallfiles
do
tail +2 "$file" >> bigfile
done
How will it work? For loop read all the files from current directory with wild chard character * chr*_smallfiles and assign the file name to variable file and tail +2 $file will output all the lines of that file except the first line and append in file bigfile. So finally all files will be merged (accept the first line of each file) into one i.e. file bigfile.
Just for completeness, how about a sed solution?
for file in chr*_smallfiles
do
sed -n '2,$p' $file >> bigfile
done
Hope it helps!
I'm attempting to remove a certain pattern from a line, but not the entire line itself. An example would be:
Original:
user=dannyBoy
Desired:
dannyBoy
I have a file that is full of lines like that, so I was wondering how I would be able to cut a specific part of the text off, whether that be just removing the first five characters from the list or searching for the pattern "user=" and removing it.
There are many ways to do this:
cut -d'=' -f2- file
sed 's/^[^=]*//' file
awk -F= '{print $2}' file #if just one = is present
cut sets a delimiter (-d'=) and then prints all the fields starting from the 2nd one (-f2-).
sed looks for all the content from the beginning up to the first = and removes it.
awk sets = as field separator and prints the second field.
Using ex:
echo user=dannyBoy | ex -s +"norm df=" +%p -cq! /dev/stdin
where ex is equivalent to vi -e/vim -e which basically executes vi command: df= (delete until finds =), then print the buffer (%p).
If you've multiple lines like that, then it would be simpler by using substitution:
ex -s +"%s/^.*=//g" +%p -cq! foo.txt
To edit file in place, change -cq! to -cwq.
The command below deletes the first 5 characters:
$ echo "user=dannyboy" | cut -c 6-
You can use it on a file with cut -c 6- inputfilename as well.