How to use lines in a file as keyword for grep? - bash

Question

I've search lots of questions on here and other sites, and people have suggested things that should fix my problem, but I think there's something wrong with my code that I just don't recognize.
I have 24 .fasta files from NGS sequencing that are 150bp long. There's approximately 1M reads for each file. The reads are from targeted sequencing where we electroplated vectors with cDNA for genes of interest, and a unique barcode sequence. I need to look through the sequencing files for the presence or absence of the barcode sequence which corresponds to a specific gene.
I have a .txt list of the barcodeSequences that I want to pass to grep to look for the barcode in the .fasta file. I've tried so many variations of this command. I can give grep each barcode individually but that's so time consuming, I know it's possible to give it the list of barcode sequences and search each .fasta for each of the barcodes and record how many times each barcode is found in each file.
Here's my code where I give it each barcode individually:
# Barcode 33
mkdir --mode 755 $dir/BC33
FILES="*.fasta"
for f in $FILES; do
cat "$f" | tr -d "\n" | tr ">" "\n" | grep 'TATTAGAGTTTGAGAATAAGTAGT' > $dir/BC33/"$f"
done
I tried to adapt it so that I don't have to feed every barcode sequence in individually:
dir="/home/lozzib/AG_Barcode_Seq/"
cd $dir
FILES="*.fasta"
for f in $FILES; do
cat "$f" | tr -d "\n" | tr ">" "\n" | grep -c -f BarcodeScreenSeq.txt | sort > $dir/Results/"$f"
echo "Finished $f"
done
But it is not searching for the barcode sequences. With this iteration it is just returning new files in the /Results directory that are empty. I also tried a nest loop, where I tried to make the barcode sequence a variable that changed like the $FILES, but that just gave me a new file with the names of my .fasta files:
dir="/home/lozzib/AG_Barcode_Seq/"
cd $dir
FILES="*.fasta"
for f in $FILES; do
for b in `cat /home/lozzib/AG_Barcode_Seq/BarcodeScreenSeq.txt`; do
cat "$f" | grep -c "$b" | sort > $dir/"$f"_Barcode
done ;
done
I want a output .txt file that has:
<barcode sequence>: <# of times that bc was found>
for each .fasta file because I want to put all the samples together to make one large excel sheet which shows each barcode and how many times it was found in each sample.
Please help, I've tried everything I can think of.
EDIT
Here is what the BarcodeScreenSeq.txt file would look like. It's just a txt file where each line is a barcode sequence:
head BarcodeScreenSeq.txt
TATTATGAGAAAGTTGAATAGTAG
ATGAAAGTTAGAGTTTATGATAAG
AATAGATAAGATTGATTGTGTTTG
TGTTAAATGTATGTAGTAATTGAG
ATAGATTTAAGTGAAGAGAGTTAT
GAATGTTTGTAAATGTATAGATAG
AAATTGTGAAAGATTGTTTGTGTA
TGTAAGTGAAATAGTGAGTTATTT
GAATTGTATAAAGTATTAGATGTG
AGTGAGATTATGAGTATTGATTTA
EDIT
lozzib#gliaserver:~/AG_Barcode_Seq$ file BarcodeScreenSeq.txt
BarcodeScreenSeq.txt: ASCII text, with CRLF line terminators

Answer 1

Windows Line Endings
Your BarcodeScreenSeq.txt has windows line endings. Each line ends with the special characters \r\n. Linux tools such as grep only deal with linux line endings \r and interpret your file ...
TATTATG\r\n
ATGAAAG\r\n
...
to look for the patterns TATTATG\r, ATGAAAG\r, ... (note the \r at the end). Because of the \r there is no match.
Either: Convert your file once bye running dos2unix BarcodeScreenSeq.txt or sed -i 's/\r//g' BarcodeScreenSeq.txt. This will change your file.
Or: replace every BarcodeScreenSeq.txt in the following scripts by <(tr -d '\r' < BarcodeScreenSeq.txt). This won't change the file, but creates more overhead as the file is converted over and over again.
Command
grep -c has only one counter. If you pass multiple search patterns at once (for instance using -f BarcodeScreenSeq.txt) you still get only one number for all patterns together.
To count the occurrences of each pattern individually you can use the following trick:
for file in *.fasta; do
grep -oFf BarcodeScreenSeq.txt "$file" |
sort | uniq -c |
awk '{print $2 ": " $1 }' > "Results/$file"
done
grep -o will print each match as a single line.
sort | uniq -c will count how often each line occurs.
awk is only there to change the format from #matches pattern to pattern: #matches.
Benefit: The command should be fairly fast.
Drawback: Patterns from BarcodeScreenSeq.txt that are not found in $file won't be listed at all. Your result will leave out lines of the form pattern: 0.
If you really need the lines of the form pattern: 0 you could use another trick:
for file in *.fasta; do
grep -oFf BarcodeScreenSeq.txt "$file" |
cat - BarcodeScreenSeq.txt |
sort | uniq -c |
awk '{print $2 ": " ($1 - 1) }' > "Results/$file"
done
cat - BarcodeScreenSeq.txt will insert the content of BarcodeScreenSeq.txt at the end of grep's output such that #matches is one bigger than it should be. The number is corrected by awk.

Answer 2

You can read a text file one line at a time and process each line separately using a redirect, like so:
for f in *.fasta; do
while read -r seq; do
grep -c "${seq}" "${f}" > "${dir}"/"${f}"_Barcode
done < /home/lozzib/AG_Barcode_Seq/BarcodeScreenSeq.txt
done