I have a Fortran 77 code like this, more or less:
nMaxRow=100
nMaxStep=100
! initialization of the matrix if Step=1
do step=1,nMaxStep
if (step.eq.1) then
do ii=1,nMaxRow
do jj=1,nMaxStep
A(ii,jj)=0
end do
end do
end if
!now for each step and for each row update the cell of the matrix
do ii=1,nMaxRow
A(ii,step)=X(ii) !X(ii) is a number associated with the specific ow at that specific step
end do
!Now I want to write the updated matrix at this step into a text file,
!How can I do that????
end do !close the do step...
Is it possible to update the values of the matrix and write the updated matrix at that specific step into a text file? I mean, without appending the results each step...
I found out that for Fortran 90 the 'REPLACE' command exists... but I couldn't find anything similar for Fortran 77.
One simple idea would be deleting the file just before writing a new one... but I don't like it and I don't know how to do it anyway.
If the file is already open (from the previous writing), you can just go the the start of the file using
rewind(unitnumber)
and start writing again. It will delete the original content of the file and start again. If you wan't to go back just be several records, you can use backtrace(), but you probably don't want that here.
If it isn't open, just open it and start writing. Unless you open it of appending, it will overwrite the original content.
Related
I'm currently developing a QGIS plug-in.
When i start editing a layer either with with edit(QgsVectorLayer) or with QgsVectorLayer.startediting() this RuneTimeError happens the majority of runs: RuntimeError: wrapped C/C++ object of type QgsVectorLayer has been deleted. I can run 10 times the script and have no error and then run it another 10 times and get 10 times in a row the error. It feels completely random.
As i understood by reading post such as Understanding the "underlying C/C++ object has been deleted" error it might be a garbage collector problem C++ side. But none of the post i saw was about QgsVectorLayer so i'm not really sure it applies.
It really annoys me to the point where i start creating empty layers to store modified features instead of editing.
I tried to move start editing before the loop as i was thinking to continually start editing and commit changes for each feature might cause the issue but the error still appears.
Then i thought it might be the use of break at the end but removing it doesn't resolve the error.
As it is the first time i really use PyQGIS i spent sometimes reading the developer cookbook or searching online (Anita Graser - creating and editing a new vector layer) but i could not find any solutions.
I tried with different version, LTR or not. With another computer by despair but the issue is still here.
I also read somewhere that the progress bar was the issue, so i removed the feedback in my script also without success.
Here are some code example :
nodesLayer = self.parameterAsVectorLayer(parameters, self.INPUT_NODE, context)
arcsLayer = self.parameterAsVectorLayer(parameters, self.INPUT_LINE, context)
# Fill node Id_line_x
# Create spatial index
index = QgsSpatialIndex(nodesLayer.getFeatures())
for line in arcsLayer.getFeatures():
# Construct a geometry engine to speed up spatial relationship
engine = QgsGeometry.createGeometryEngine(line.geometry().constGet())
engine.prepareGeometry()
# Get potential neighbour
candidateIds = index.intersects(line.geometry().boundingBox())
request = QgsFeatureRequest().setFilterFids(candidateIds)
for node in nodesLayer.getFeatures(request):
# Get real neighbour
if engine.intersects(node.geometry().constGet()):
# Fill the Id_line fields for the number of neighbour
for fld in range(1, node["Nb_seg"] + 1):
if node["fk_Id_line_%d" %fld] == NULL:
with edit(nodesLayer):
node["fk_Id_line_%d" %fld] = line["Id_line"]
nodesLayer.updateFeature(node)
break
And the exact error :
Traceback (most recent call last):
File "/some/path/to/a/file.py", line 331, in processAlgorithm
nodesLayer.updateFeature(node)
RuntimeError: wrapped C/C++ object of type QgsVectorLayer has been deleted
Hope the example is enough. The goal of the code is for the nodes to be aware of their surroundings without going through the lines. it's just for treatment and those fields would be removed in the final output.
So I'm able to create a nice table of contents with pandoc --toc option, but I was wondering if there is any way of linking the header or a symbol near the heading back to the table of contents. For example, when you create a footnote in pandoc, it links the subscript number to the bottom of the page. At the end of the note, there is this little sign (↩︎) with a link for going back to the line where the footnote was. I'd like to do this with my table of contents for each header. I don't mind not use --toc, and instead manually writing out the table of contents, but I not sure whether this particular feature was available. Any tips would be very helpful!
A Lua filter can be used to add a link back to the TOC.
local link_to_toc = pandoc.Link({pandoc.Str '↑'}, '#TOC')
function Header (h)
h.content = h.content .. {pandoc.Space(), link_to_toc}
return h
end
Save the above into a file and pass it to pandoc via the --lua-filter (or -L) command line option.
Linking to a specific line in the TOC is not possible though.
I have a huge text file and I want to use grep to search if some "blocks" in my text file is existing in another file. So, I need to extract these blocks first.
This is my file:
>gi|60117238|gb|AY897435.1| Wolbachia endosymbiont of Drosophila mojavensis, genomic survey sequence
TCTGTTGCGAGTGTGCTGATAACTACTGAATCTATGATAGTTGATGTACCAAGCAAAGAAAATGCTTCATCTCCTATGGG
TGCAGGAGAAATGAGTGGCATGGGTGGATTCTAAGTAGAATGAAACCGTGGAGCAATTGCTCCACGGTAGTTCCAAAAAA
TCTCACATTTTACTATTCGTTAAAGGTAATACGTTTGGTGCAGAAATGCACTACTGTTTGCATCCGTTTCGCTCCTTTAT
ATTGTGGTTGTCTAATAACAAAAAGGCAGCATAAGAAAACTATAACACCTAGTATATTTATACTATAGCTGACCCAAGCA
ACACGTCATACCGCGATTCATTCCACAACTGTACGAACATTACAATATGGCACATAGTAAACGATGTCATGAAAGTAGCT
GACACTGGAATTCAGAAAAAAGGATTATGTCATTCCAGTGCTTGACACTGGAATCCAGCATTTCCATAATCATCAAAACA
TTGTATTTTAACAAAAAACATGTATTTTTATGCTTGCCAACTTAATAAAATTCCTGGATCCCAGTGTCAAGCACTGGGAT
GACAC
>gi|60117239|gb|AY897436.1| Wolbachia endosymbiont of Drosophila mojavensis, genomic survey sequence
TTTTCATCGCTCATGTCCTTAGTTTACCCCCTGTTTCACCATTACATTAATATCTACAGAACCTCCCACTGGGGAGTAGT
AATCTAGGATAGTTTCTATCACTAAAACGCGTGGTATTCCTTTATTTTTTACCAATTTTAAATAAGACAATACCTTATTA
TCATCATAATGCTGCAGAAAGCGGCAAAAGACACCTAATTCATAATTTGTAGCTGATAATTCTTCTTGAGTTATGAGTTT
AATTTTTAAATCTTCTACTGCCTGCCTAGGCACTTTATGTTCGTTGTAATAATATAAGCCTATAGAACCTTTATTGTGTA
TATCAGAATAAGCAAGAAATAAAGAGTGTACGCCAAATAGCAATATATTTTTAGCACCATCTATATTAACCCTAGAATTA
AACTCTTTAGTGTCAAACCTGGAATATCCTAGCAATGCTTGGTAAAACGCTATTTTCCTGTCTTCTGATGTTTCTTTCTC
CTTAAAAAGAATCAAATGAAAATATTGACTCCTGCCTTAAAATATCCGGCATTTTTAACCAATTCTTTTCAGCGGCAACC
CTTGCCCACATTGCTGCTGCTTTAGGAAAAATGGTATTTCTTTAAACACTTACCTTTTGATGAAAGTTGCCCAAAATCCT
TTGTTCTATCCGAATCCAAAACCCCTATTTCCCAAACGCCCCTTAAAACCTTTTTTAAAATTGGAACAAAAAATATTTAA
TTTTTAAAAAAAAACG
>gi|60117240|gb|AY897437.1| Wolbachia endosymbiont of Drosophila mojavensis, genomic survey sequence
TTGNCCATCAATTGGCCACCAGAAAAGTTGCGTCCGTTTACTTCTACACCATGTATAAATGCACCTAAAATCATGCCTTG
GCAAAATGCAGCACCAAGTGACCCAAAATGAAAGGCATAATCCCATAATCGCCTGTATTTTCCTTCTGCCTTAAAACGAA
ACTCAAAGGATACTCCGCGCACTATAAGGCCAAGCAGCATAATAATGATTGGAATATAAAAAGCAGGCATTAATATTGAA
TATGCAAGAGGAAAAGCAGCAAACAACCCTCCACCACCTAGTACCAACCATGTTTCGTTTCCATCCCAAAATGGTGCAAT
TGAGCTTATCATGTGATCACGGCATTTATCTGACGGTGCAAAAGGAAGTAAAATACCAATACCTAAATCAAACCCATCCA
TTAAAATATACAGTAAAACAGCTATGGCAATTAGTAATCCCCAGATTAGGGGTAAATTAATTAAGGAAGAAAAATCAAAC
ATGATTGTTGTCCTTTCCAGATGTACCAGCATCAATCACTGAAGCTCCAATACCGTGTTTATAAAATTGCTCTTCTTCTT
TAATGACAGGAATTCCTTTGTATATAAGTTTCAGAATATAGTATCTACCTGCTCCAAATATAAGGGTATACATAAACGAT
AAATGCAATCAAAGACCATGCAACCTGAGGACCGGTAATCGCAGATGAAAATGATTCAATTGTGCCGTTAATTCCATATA
CAGTGTAAAGTTGACGGCCAATTTCATAGTAAACCAAACTGCAAGTAACGCTATGGACCCCGACGGCATCTTTGAAATCC
ACAATCCTTTGAAAACACAACTTTGGAATAATTTGCCCCGAAAAATACTGAAAAAAAATTTACTGGACCCATTTTGGATT
ATTAAAATTTCAACTCCAACCATTTATACGGG
Block is starting from > to the letter befor the next >.
So, 1st block is:
TCTGTTGCGAGTGTGCTGATAACTACTGAATCTATGATAGTTGATGTACCAAGCAAAGAAAATGCTTCATCTCCTATGGG
TGCAGGAGAAATGAGTGGCATGGGTGGATTCTAAGTAGAATGAAACCGTGGAGCAATTGCTCCACGGTAGTTCCAAAAAA
TCTCACATTTTACTATTCGTTAAAGGTAATACGTTTGGTGCAGAAATGCACTACTGTTTGCATCCGTTTCGCTCCTTTAT
ATTGTGGTTGTCTAATAACAAAAAGGCAGCATAAGAAAACTATAACACCTAGTATATTTATACTATAGCTGACCCAAGCA
ACACGTCATACCGCGATTCATTCCACAACTGTACGAACATTACAATATGGCACATAGTAAACGATGTCATGAAAGTAGCT
GACACTGGAATTCAGAAAAAAGGATTATGTCATTCCAGTGCTTGACACTGGAATCCAGCATTTCCATAATCATCAAAACA
TTGTATTTTAACAAAAAACATGTATTTTTATGCTTGCCAACTTAATAAAATTCCTGGATCCCAGTGTCAAGCACTGGGAT
GACAC
2nd block is:
TTTTCATCGCTCATGTCCTTAGTTTACCCCCTGTTTCACCATTACATTAATATCTACAGAACCTCCCACTGGGGAGTAGT
AATCTAGGATAGTTTCTATCACTAAAACGCGTGGTATTCCTTTATTTTTTACCAATTTTAAATAAGACAATACCTTATTA
TCATCATAATGCTGCAGAAAGCGGCAAAAGACACCTAATTCATAATTTGTAGCTGATAATTCTTCTTGAGTTATGAGTTT
AATTTTTAAATCTTCTACTGCCTGCCTAGGCACTTTATGTTCGTTGTAATAATATAAGCCTATAGAACCTTTATTGTGTA
TATCAGAATAAGCAAGAAATAAAGAGTGTACGCCAAATAGCAATATATTTTTAGCACCATCTATATTAACCCTAGAATTA
AACTCTTTAGTGTCAAACCTGGAATATCCTAGCAATGCTTGGTAAAACGCTATTTTCCTGTCTTCTGATGTTTCTTTCTC
CTTAAAAAGAATCAAATGAAAATATTGACTCCTGCCTTAAAATATCCGGCATTTTTAACCAATTCTTTTCAGCGGCAACC
CTTGCCCACATTGCTGCTGCTTTAGGAAAAATGGTATTTCTTTAAACACTTACCTTTTGATGAAAGTTGCCCAAAATCCT
TTGTTCTATCCGAATCCAAAACCCCTATTTCCCAAACGCCCCTTAAAACCTTTTTTAAAATTGGAACAAAAAATATTTAA
TTTTTAAAAAAAAACG
Third block:
TTGNCCATCAATTGGCCACCAGAAAAGTTGCGTCCGTTTACTTCTACACCATGTATAAATGCACCTAAAATCATGCCTTG
GCAAAATGCAGCACCAAGTGACCCAAAATGAAAGGCATAATCCCATAATCGCCTGTATTTTCCTTCTGCCTTAAAACGAA
ACTCAAAGGATACTCCGCGCACTATAAGGCCAAGCAGCATAATAATGATTGGAATATAAAAAGCAGGCATTAATATTGAA
TATGCAAGAGGAAAAGCAGCAAACAACCCTCCACCACCTAGTACCAACCATGTTTCGTTTCCATCCCAAAATGGTGCAAT
TGAGCTTATCATGTGATCACGGCATTTATCTGACGGTGCAAAAGGAAGTAAAATACCAATACCTAAATCAAACCCATCCA
TTAAAATATACAGTAAAACAGCTATGGCAATTAGTAATCCCCAGATTAGGGGTAAATTAATTAAGGAAGAAAAATCAAAC
ATGATTGTTGTCCTTTCCAGATGTACCAGCATCAATCACTGAAGCTCCAATACCGTGTTTATAAAATTGCTCTTCTTCTT
TAATGACAGGAATTCCTTTGTATATAAGTTTCAGAATATAGTATCTACCTGCTCCAAATATAAGGGTATACATAAACGAT
AAATGCAATCAAAGACCATGCAACCTGAGGACCGGTAATCGCAGATGAAAATGATTCAATTGTGCCGTTAATTCCATATA
CAGTGTAAAGTTGACGGCCAATTTCATAGTAAACCAAACTGCAAGTAACGCTATGGACCCCGACGGCATCTTTGAAATCC
ACAATCCTTTGAAAACACAACTTTGGAATAATTTGCCCCGAAAAATACTGAAAAAAAATTTACTGGACCCATTTTGGATT
ATTAAAATTTCAACTCCAACCATTTATACGGG
How can I loop my file and extract one block in each iteration? To grep it with the other file?
Edit 1:
For more clarification:
I want to do some operation on each block. First, I perform diff between two files and but the result in a new file. For the new file which contains the blocks, i want to search if each block is included in the first file or in the second file. If it is included in the first file, i want to extract it to another new file. If it is included in the second file, i want to escape and go to next block.
Hope you getting my point.
Thanks,
Do you want to create a separate file for each block? And then you want to do any operation on those files? Or you just want to do some operation(say search/grep) for each block in each loop iteration? Please clarify your requirement.
Probably a simple question, but I need to delete the contents of a file after a specific line number? So I wan't to keep the first e.g 5 lines and delete the rest of the contents of a file. I have been searching for a while and can't find a way to do this, I am an iOS developer so Ruby is not a language I am very familiar with.
That is called truncate. The truncate method needs the byte position after which everything gets cut off - and the File.pos method delivers just that:
File.open("test.csv", "r+") do |f|
f.each_line.take(5)
f.truncate( f.pos )
end
The "r+" mode from File.open is read and write, without truncating existing files to zero size, like "w+" would.
The block form of File.open ensures that the file is closed when the block ends.
I'm not aware of any methods to delete from a file so my first thought was to read the file and then write back to it. Something like this:
path = '/path/to/thefile'
start_line = 0
end_line = 4
File.write(path, File.readlines(path)[start_line..end_line].join)
File#readlines reads the file and returns an array of strings, where each element is one line of the file. You can then use the subscript operator with a range for the lines you want
This isn't going to be very memory efficient for large files, so you may want to optimise if that's something you'll be doing.
I have a variable called random number that needs to be stored when the application has be shutdown or the computer has been shutdown. Every time this number is used I also need to +1 to it.
I have a few variables in my current vb6 application that need to be saved when the app is closed and loaded when the app is launched. Is this possible? I could use a text file or a config file to store the variables?
EDIT -------------------------------------------------------------------------------
I managed to fix this problem had just using a simple input and output text file. Please read my answer below if you have the same problem and need assistance.
The standard way to save values in VB6 apps was to use INI files. If I remember there are a couple of Win32 functions to read/write them.
They are GetPrivateProfileString and WritePrivateProfileString.
Using the registry is the correct way to do it.
VB has built in functions SaveSetting and GetSetting for writing to and reading from the registry.
See registry tutorial or Stack Overflow question to help you out.
I managed to complete the task by creating a file in my C Drive and putting in the number "123" to the top line of the text file. I then wrote the following code:
Function GetPOIRandomNum()
Dim LineA As String
'Collect stored variables
Open "C:\TestPartner\Config\POIRandomNum.txt" For Input As #1
While Not EOF(1)
Line Input #1, LineA 'Read the first line in the file
POIRandomNum = LineA + 1 'Give POIRandomNum the integer from line 1 and add 1 to it
Wend
Close #1
'Save the new random number variable to the file
Open "C:\TestPartner\Config\POIRandomNum.txt" For Output As #1 'Open for output to replace the old number
Write #1, POIRandomNum 'Input the new number to the text file
Close #1
End Function
Now whenever the Random number Variable is needed I call the above function.