I have some output files (5000 files) of .log which are the results of QM computations. Inside each file there are two special lines indicate the number of electrons and orbitals, like this below as an example (with exact spaces as in output files):
Number of electrons = 9
Number of orbitals = 13
I thought about a script (bash or Fortran), as a solution to this problem, which grep these two lines (at same time) and get the corresponding integer values (9 and 13, for instance), compare them and finds the difference between two values, and finally, list them in a new text file with the corresponding filenames.
I would really appreciate any help given.
Am posting an attempt in GNU Awk, and have tested it in that only.
#!/bin/bash
for file in *.log
do
awk -F'=[[:blank:]]*' '/Number of/{printf "%s%s",$2,(NR%2?" ":RS)}' "$file" | awk 'function abs(v) {return v < 0 ? -v : v} {print abs($1-$2)}' >> output_"$file"
done
The reason I split the AWK logic to two was to reduce the complexity in doing it in single huge command. The first part is for extracting the numbers from your log file in a columnar format and second for getting their absolute value.
I will break-down the AWK logic:-
-F'=[[:blank:]]*' is a mult0 character delimiter logic including = and one or more instances of [[:blank:]] whitespace characters.
'/Number of/{printf "%s%s",$2,(NR%2?" ":RS)}' searches for lines starting with Number of and prints it in a columnar fashion, i.e. as 9 13 from your sample file.
The second part is self-explanatory. I have written a function to get the absolute value from the two returned values and print it.
Each output is saved in a file named output_, for you to process it further.
Run the script from your command line as bash script.sh, where script.sh is the name containing the above lines.
Update:-
In case if you are interested in negative values too i.e. without the absolute function, change the awk statement to
awk -F'=[[:blank:]]*' '/Number of/{printf "%s%s",$2,(NR%2?" ":RS)}' "$file" | awk '{print ($1-$2)}' >> output_"$file"
Bad way to do it (but it will work)-
while read file
do
first=$(awk -F= '/^Number/ {print $2}' "$file" | head -1)
second=$(awk -F= '/^Number/ {print $2}' "$file" | tail -1)
if [ "$first" -gt "$second" ]
then
echo $(("$first" - "$second"))
else
echo $(("$second" - "$first"))
fi > "$file"_answer ;
done < list_of_files
This method picks up the values (in the awk one liner and compares them.
It then subtracts them to give you one value which it saves in the file called "$file"_answer. i.e. the initial file name with '_answer' as a suffix to the name.
You may need to tweak this code to fit your purposes exactly.
Related
I have a task where I'm given an input of the format:
4
A CS 22 M
B ECE 23 M
C CS 23 F
D CS 22 F
as the user input from the command line. From this, we have to perform tasks like determine the number of male and female students, determine which department has the most students, etc. I have done this using awk with the input as a file. Is there any way to do this with a user input instead of a file?
Example of a command I used for a file (where the content in the file is in the same format):
numberofmales=$(awk -F ' ' '{print $4}' file.txt | grep M | wc -l) #list number of males
Not Reproducible
It works fine for me, so your problem can't be reproduced with either GNU or BSD awk under Bash 5.0.18(1). With your posted code and file sample:
$ numberofmales=$(awk -F ' ' '{print $4}' file.txt | grep M | wc -l)
$ echo $numberofmales
2
Check to make sure you don't have problems in your input file, or elsewhere in your code.
Also, note that if you call awk without a file argument or input from a pipe, it tries to collect data from standard input. It may not actually be hanging; it's probably just waiting on end-of-file, which you can trigger with CTRL+D.
Recommended Improvements
Even if your code works, it can be improved. Consider the following, which skips the unnecessary field-separator definition and performs all the actions of your pipeline within awk.
males=$(
awk 'tolower($4)=="m" {count++}; END {print count}' file.txt
)
echo "$males"
Fewer moving parts are often easier to debug, and can often be more performant on large datasets. However, your mileage may vary.
User Input
If you want to use user input rather than a file, you can use standard input to collect your data, and then pass it as a quoted argument to a function. For example:
count_males () {
awk 'tolower($4)=="m" {count++}; END {print count}' <<< "$*"
}
echo "Enter data (CTRL-D when done):"
data=$(cat -)
# If at command prompt, wait until EOF above before
# pasting this line. Won't matter in scripts.
males=$(count_males "$data")
The result is now stored in males, and you can echo "$males" or make use of the variable in whatever other way you like.
Bash indeed does not care whether a file handle is connected to standard input or to a file, and neither does Awk.
However, if you want to pass the same input to multiple Awk instances, it really does make sense to store it in a temporary file.
A better overall solution is to write a better Awk script so you only need to read the input once.
awk 'NF > 1 { ++a[$4] } END { for (g in a) print g, a[g] }'
Demo: https://ideone.com/0ML7Xk
The NF > 1 condition is to skip the silly first line. Probably don't put that information there in the first place and let Awk figure out how many lines there are; it's probably better at counting than you are anyway.
I have a file with 2 columns, and i want to use the values from the second column to set the range in the cut command to select a range of characters from another file. The range i desire is the character in the position of the value in the second column plus the next 10 characters. I will give an example in a while.
My files are something like that:
File with 2 columns and no blank lines between lines (file1.txt):
NAME1 10
NAME2 25
NAME3 48
NAME4 66
File that i want to extract the variable range of characters(just one very long line with no spaces and no bold font) (file2.txt):
GATCGAGCGGGATTCTTTTTTTTTAGGCGAGTCAGCTAGCATCAGCTACGAGAGGCGAGGGCGGGCTATCACGACTACGACTACGACTACAGCATCAGCATCAGCGCACTAGAGCGAGGCTAGCTAGCTACGACTACGATCAGCATCGCACATCGACTACGATCAGCATCAGCTACGCATCGAAGAGAGAGC
...or, more literally (for copy/paste to test):
GATCGAGCGGGATTCTTTTTTTTTAGGCGAGTCAGCTAGCATCAGCTACGAGAGGCGAGGGCGGGCTATCACGACTACGACTACGACTACAGCATCAGCATCAGCGCACTAGAGCGAGGCTAGCTAGCTACGACTACGATCAGCATCGCACATCGACTACGATCAGCATCAGCTACGCATCGAAGAGAGAGC
Desired resulting file, one sequence per line (result.txt):
GATTCTTTTT
GGCGAGTCAG
CGAGAGGCGA
TATCACGACT
The resulting file would have the characters from 10-20, 25-35, 48-58 and 66-76, each range in a new line. So, it would always keep the range of 10, but in different start points and those start points are set by the values in the second column from the first file.
I tried the command:
for i in $(awk '{print $2}' file1.txt);
do
p1=$i;
p2=`expr "$1" + 10`
cut -c$p1-$2 file2.txt > result.txt;
done
I don't get any output or error message.
I also tried:
while read line; do
set $line
p2=`expr "$2" + 10`
cut -c$2-$p2 file2.txt > result.txt;
done <file1.txt
This last command gives me an error message:
cut: invalid range with no endpoint: -
Try 'cut --help' for more information.
expr: non-integer argument
There's no need for cut here; dd can do the job of indexing into a file, and reading only the number of bytes you want. (Note that status=none is a GNUism; you may need to leave it out on other platforms and redirect stderr otherwise if you want to suppress informational logging).
while read -r name index _; do
dd if=file2.txt bs=1 skip="$index" count=10 status=none
printf '\n'
done <file1.txt >result.txt
This approach avoids excessive memory requirements (as present when reading the whole of file2 -- assuming it's large), and has bounded performance requirements (overhead is equal to starting one copy of dd per sequence to extract).
Using awk
$ awk 'FNR==NR{a=$0; next} {print substr(a,$2+1,10)}' file2 file1
GATTCTTTTT
GGCGAGTCAG
CGAGAGGCGA
TATCACGACT
If file2.txt is not too large, then you can read it in memory,
and use Bash sub-strings to extract the desired ranges:
data=$(<file2.txt)
while read -r name index _; do
echo "${data:$index:10}"
done <file1.txt >result.txt
This will be much more efficient than running cut or another process for every single range definition.
(Thanks to #CharlesDuffy for the tip to read data without a useless cat, and the while loop.)
One way to solve it:
#!/bin/bash
while read line; do
pos=$(echo "$line" | cut -f2 -d' ')
x=$(head -c $(( $pos + 10 )) file2.txt | tail -c 10)
echo "$x"
done < file1.txt > result.txt
It's not the solution an experienced bash hacker would use, but it is very good for someone who is new to bash. It uses tools that are very versatile, although somewhat bad if you need high performance. Shell scripting is commonly used by people who rarely shell scripts, but knows a few commands and just wants to get the job done. That's why I'm including this solution, even if the other answers are superior for more experienced people.
The first line is pretty easy. It just extracts the numbers from file1.txt. The second line uses the very nice tools head and tail. Usually, they are used with lines instead of characters. Nevertheless, I print the first pos + 10 characters with head. The result is piped into tail which prints the last 10 characters.
Thanks to #CharlesDuffy for improvements.
given this question Appending a line to a file only if it does not already exist
is there a faster way than the solution provided by #drAlberT?
grep -q -F 'string' foo.bar || echo 'string' >> foo.bar
I have implemented the above solution and I have to iterate it over a 500k lines file (i.e. check if a line is not already in a 500k lines set). Moreover, I've to run this process for a lot of times, maybe 10-50 million times. Needless to say it's kind of slow as it takes 25-30ms to run on my server (so 3-10+ days of runtime in total).
EDIT: the flow is the following: I have a file with 500k lines, each time I run, I get maybe 10-30 new lines and I check if they are already there or not. If not I add them, then I repeat many times. The order of my 500k lines files is important as I'm going through it with another process.
EDIT2: the 500k lines file is always containing unique lines, and I only care about "full lines", no substrings.
Thanks a lot!
Few suggested improvements:
Try using awk instead of grep so that you can both detect the string and write it in one action;
If you do use grep don't use a Bash loop to feed each potential match to grep and then append that one word to the file. Instead, read all the potential lines into grep as matches (using -f file_name) and print the matches. Then invert the matches and append the inverted match. See last pipeline here;
Exit as soon as you see the string (for a single string) rather than continuing to loop over a big file;
Don't call the script millions of times with one or just a few lines -- organize the glue script (in Bash I suppose) so that the core script is called once or a few times with all the lines instead;
Perhaps use multicores since the files are not dependent on each other. Maybe with GNU Parallel (or you could use Python or Ruby or Perl that has support for threads).
Consider this awk for a single line to add:
$ awk -v line=line_to_append 'FNR==NR && line==$0{f=1; exit}
END{if (!f) print line >> FILENAME}' file
Or for multiple lines:
$ awk 'FNR==NR {lines[$0]; next}
$0 in lines{delete lines[$0]}
END{for (e in lines) print e >> FILENAME}' lines file
Some timings using a copy of the Unix words file (235,886 lines) with a five line lines file that has two overlaps:
$ echo "frob
knob
kabbob
stew
big slob" > lines
$ time awk 'FNR==NR {lines[$0]; next}
$0 in lines{delete lines[$0]}
END{for (e in lines) print e >> FILENAME}' lines words
real 0m0.056s
user 0m0.051s
sys 0m0.003s
$ tail words
zythum
Zyzomys
Zyzzogeton
frob
kabbob
big slob
Edit 2
Try this as being the best of both:
$ time grep -x -f lines words |
awk 'FNR==NR{a[$0]; next} !($0 in a)' - lines >> words
real 0m0.012s
user 0m0.010s
sys 0m0.003s
Explanation:
grep -x -f lines words find the lines that ARE in words
awk 'FNR==NR{a[$0]; next} !($0 in a)' - lines invert those into lines that are NOT in words
>> words append those to the file
Turning the millions of passes over the file into a script with millions of actions will save you a lot of overhead. Searching for a single label at each pass over the file is incredibly inefficient; you can search for as many labels as you can comfortably fit into memory in a single pass over the file.
Something along the following lines, perhaps.
awk 'NR==FNR { a[$0]++; next }
$0 in a { delete a[$0] }
1
END { for (k in a) print k }' strings bigfile >bigfile.new
If you can't fit strings in memory all at once, splitting that into suitable chunks will obviously allow you to finish this in as many passes as you have chunks.
On the other hand, if you have already (effectively) divided the input set into sets of 10-30 labels, you can obviously only search for those 10-30 in one pass. Still, this should provide you with a speed improvement on the order of 10-30 times.
This assumes that a "line" is always a full line. If the label can be a substring of a line in the input file, or vice versa, this will need some refactoring.
If duplicates are not valid in the file, just append them all and filter out the duplicates:
cat myfile mynewlines | awk '!n[$0]++' > mynewfile
This will allow appending millions of lines in seconds.
If order additionally doesn't matter and your files are more than a few gigabytes, you can use sort -u instead.
Have the script read new lines from stdin after consuming the original file. All lines are stored in an associative array (without any compression such as md5sum).
Appending the suffix 'x' is targeted to handle inputs such as '-e'; better ways probably exist.
#!/bin/bash
declare -A aa
while read line; do aa["x$line"]=1;
done < file.txt
while read line; do
if [ x${aa[$line]} == x ]; then
aa[$line]=1;
echo "x$line" >> file.txt
fi
done
Input
A file called input_file.csv, which has 7 columns, and n rows.
Example header and row:
Date Location Team1 Team2 Time Prize_$ Sport
2016 NY Raptors Gators 12pm $500 Soccer
Output
n files, where the rows in each new file are grouped based on their values in column 7 of the original file. Each file is named after that shared value from column 7. Note: each file will have the same header. (The script currently does this.)
Example: if 2 rows in the original file had golf as their value for column 7, they would be grouped together in a file called golf.csv. If 3 other rows shared soccer as their value for column 7, they would be found in soccer.csv.
An array that has the name of each generated file in it. This array lives outside of the scope of awk. (This is what I need help with.)
Example: Array = [golf.csv, soccer.csv]
Situation
The following script produces the desired output. However, I want to run another script on each of the newly generated files and I don't know how.
Question:
My idea is to store the names of each new file in an array. That way, I can loop through the array and do what I want to each file. The code below passes a variable called array into awk, but I don't know how to add the name of each file to the array.
#!/bin/bash
ARRAY=()
awk -v myarray="$ARRAY" -F"\",\"" 'NR==1 {header=$0}; NF>1 && NR>1 {if(! files[$7]) {print header >> ("" $7 ".csv"); files[$7]=1}; print $0 >> ("" $7 ".csv"); close("" $7 ".csv");}' input_file.csv
for i in "${ARRAY[#]}"
do
:
echo $i
done
Rather than struggling to get awk to fill your shell array variable, why not:
make sure that the *.csv files are created in a clean directory
use globbing to loop over all *.csv files in that directory?
awk -F'","' ... # your original Awk command
for i in *.csv # use globbing to loop over resulting *.csv files
do
:
echo $i
done
Just off the top of my head, untested because you haven't supplied very much sample data, what about this?
#!/usr/bin/awk -f
FNR==1 {
header=$0
next
}
! $7 in files {
files[$7]=sprintf("sport-%s.csv", $7)
print header > file
}
{
files[$7]=sprintf("sport-%s.csv", $7)
}
{
print > files[$7]
}
END {
printf("declare -a sportlist=( ")
for (sport in files) {
printf("\"%s\"", sport)
}
printf(" )\n");
}
The idea here is that we store sport names in the array files[], and build filenames out of that array. (You can format the filename inside sprintf() as you see fit.) We step through the file, adding a header line whenever we get a new sport with no recorded filename. Then for non-headers, print to the file based on the sport name.
For your second issue, exporting the array back to something outside of awk, the END block here will output a declare line which can be interpreted by bash. IF you feel lucky, you can eval this awk script inside command expansion, and the declare command will effectively be interpreted by your shell:
eval $(/path/to/awkscript inputfile.csv)
Or, if you subscribe to the school of thought that consiers eval to be evil, you can redirect the awk script's standard output to a temporary file which you source:
/path/to/awkscript inputfile.csv > /tmp/yadda.$$
. /tmp/yadda.$$
(Don't use this temp file, make a real one with mktemp or the like.)
There's no way for any program to modify the environment of the parent shell. Just have the awk script output the names of the files as standard output, and use command substitution to put them in an array.
filesArray=($(awk ... ))
If the files might have spaces in them, you need a different solution; assuming you're on bash 4, you can just be sure to print each file on a separate line and use readarray:
readarray filesArray < <( awk ... )
if the files might have newlines in them, too, then things get tricky...
if your file is not large, you can run another script to get the unique $7 elements, for example
$ awk 'NR>1&&!a[$7]++{print $7}' sports
will print the values, you can change it to your file name format as well, such as
$ awk 'NR>1&&!a[$7]++{print tolower($7)".csv"}' sports
this then can be piped to your other process, here for example to wc
$ awk ... sports | xargs wc
This will do what I THINK you want:
oIFS="$IFS"; IFS=$'\n'
array=( $(awk '{out=$7".csv"; print > out} !seen[out]++{print out}' input_file.csv) )
IFS="$oIFS"
If your input file really is comma-separated instead of space-separated as you show in the sample input in your question then adjust the awk script to suit (You might want to look at GNU awk and FPAT).
If you don't have GNU awk then you'll need to add a bit more code to close the open output files as you go.
The above will fail if you have file names that contain newlines but will be fine for blank chars or other white space.
I have a file with three columns, which has pipe as a delimiter. Now some lines in the file can have a "," instead of "|", due to some error. I want to output all such erroneous rows.
You can also use grep, it is more complicated:
egrep "\|.*\|.*\|" input
echo No pipe
egrep "^[^\|]*$" input
echo One pipe
egrep "^[^\|]*\|[^\|\]*$" input
echo 3+ pipe
egrep "\|[^\|]*\|[^\|\]*\|" input
Before combining the greps, first introduce new variables
p (pipe) and n (no pipe)
p="\|"
n="[^\|]*"
echo "p=$p, n=$n"
echo No pipe
egrep "^$n$" input
echo One pipe
egrep "^$n$p$n$" input
echo 3+ pipe
egrep "$p$n$p$n$p" input
Now bring all together
egrep "^$n$|^$n$p$n$|$p$n$p$n$p" input
Edit: The comments and variable names were about "slashes", but they are pipes (with backslashes). That was a bit confusing.
To count the number of columns with awk you can use the NF variable:
$ cat file
ABC|12345|EAR
PQRST|123|TWOEYES
ssdf|fdas,sdfsf
$ awk -F\| 'NF!=3' file
ssdf|fdas,sdfsf
However, this does not seem to cover all the possible ways the data could be corrupted based on the various revisions of the question and the comments.
A better approach would be to define the exact format that the data must follow. For example, assuming that a line is "correct" if it is three columns, with the first and third letters only, and the second numeric, you could write the following script to match all non conforming lines:
awk -F\| '!(NF==3 && $1$3 ~ /^[a-zA-Z]+$/ && $2+0==$2)' file
Test (notice that only the second line (which is conforming) does not get printed):
$ cat file
A,BC|12345|EAR
PQRST|123|TWOEYES
ssdf|fdas,sdfsf
ABC|3983|MAKE,
sf dl lfsdklf |kldsamfklmadkfmask |mfkmadskfmdslafmka
ABC|abs|EWE
sdf|123|123
$ awk -F\| '!(NF==3&&$1$3~/^[a-zA-Z]+$/&&$2+0==$2)' file
A,BC|12345|EAR
ssdf|fdas,sdfsf
ABC|3983|MAKE,
sf dl lfsdklf |kldsamfklmadkfmask |mfkmadskfmdslafmka
ABC|abs|EWE
sdf|123|12
You can adapt the above command to your specific needs, based on what you think is a valid input. For example, if you wanted to also restrict the length of each line to 50 characters, you could do
awk -F\| '!(NF==3 && $1$3 ~ /^[a-zA-Z]+$/ && $2+0==$2 && length($0)<50)' file