I have a markdown file that has snippets of code resembling the following example:
```
$ cat docs/code_sample.sh
#!/usr/bin/env bash
echo "Hello, world"
```
This means there there's a file at the location docs/code_sample.sh, whose contents is:
#!/usr/bin/env bash
echo "Hello, world"
I'd like to parse the markdown file with sed (awk or perl works too) and replace the bottom section of the code snippet with whatever the above bash command evaluates to, for example whatever cat docs/code_sample.sh evaluates to.
Perl to the rescue!
perl -0777 -pe 's/(?<=```\n)^(\$ (.*)\n\n)(?^s:.*?)(?=```)/"$1".qx($2)/meg' < input > output
-0777 slurps the whole file into memory
-p prints the input after processing
s/PATTERN/REPLACEMENT/ works similarly to a substitution in sed
/g replaces globally, i.e. as many times as it can
/m makes ^ match start of each line instead of start of the whole input string
/e evaluates the replacement as code
(?<=```\n) means "preceded by three backquotes and a newline"
(?^s:.*?) changes the behaviour of . to match newlines as well, so it matches (frugally because of the *?) the rest of the preformatted block
(?=```) means "followed by three backquotes`
qx runs the parameter in a shell and returns its output
A sed-only solution is easier if you have the GNU version with an e command.
That said, here's a quick, simplistic, and kinda clumsy version I knocked out that doesn't bother to check the values of previous or following lines - it just assumes your format is good, and bulls through without any looping or anything else. Still, for my example code, it worked.
I started by making an a, a b, and an x that is the markup file.
$: cat a
#! /bin/bash
echo "Hello, World!"
$: cat b
#! /bin/bash
echo "SCREW YOU!!!!"
$: cat x
```
$ cat a
foo
bar
" b a z ! "
```
```
$ cat b
foo
bar
" b a z ! "
```
Then I wrote s which is the sed script.
$: cat s
#! /bin/env bash
sed -En '
/^```$/,/^```$/ {
# for the lines starting with the $ prompt
/^[$] / {
# save the command to the hold space
x
# write the ``` header to the pattern space
s/.*/```/
# print the fabricated header
p
# swap the command back in
x
# the next line should be blank - add it to the current pattern space
N
# first print the line of code as-is with the (assumed) following blank line
p
# scrub the $ (prompt) off the command
s/^[$] //
# execute the command - store the output into the pattern space
e
# print the output
p
# put the markdown footer back
s/.*/```/
# and print that
p
}
# for the (to be discarded) existing lines of "content"
/^[^`$]/d
}
' $*
It does the job and might get you started.
$: s x
```
$ cat a
#! /bin/bash
echo "Hello, World!"
```
```
$ cat b
#! /bin/bash
echo "SCREW YOU!!!!"
```
Lots of caveats - better to actually check that the $ follows a line of backticks and is followed by a blank line, maybe make sure nothing bogus could be in the file to get executed... but this does what you asked, with (GNU) sed.
Good luck.
A rare case when use of getline would be appropriate:
$ cat tst.awk
state == "importing" {
while ( (getline line < $NF) > 0 ) {
print line
}
close($NF)
state = "imported"
}
$0 == "```" { state = (state ? "" : "importing") }
state != "imported" { print }
$ awk -f tst.awk file
See http://awk.freeshell.org/AllAboutGetline for getline uses and caveats.
Related
my bash for loop looks like:
for i in read_* ; do
cut -f1 $i | sponge $i
sed -i '1 s/^/>/g' $i
sed -i '3 s/^/>ref\n/g' $i
sed -i '4d' $i
sed -i '1h;2H;1,2d;4G' $i
mv $i $i.fasta
done
Are there any methods of speeding up this process, perhaps using GNU parallel?
EDIT: Added input and expected output.
Input:
sampleid 97 stuff 2086 42 213M = 3322 1431
TATTTAGGGAAGATCTGGCCTTCCTACAAGGGAAGGCCAGGGAATTTTCTTCAGAGCAGA
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
TTTTTAGGGAAGATCTGGCCTTCCTACAAGGGAAGGCCAGGGAATTTTCTTCAGAGCAGA
Hopeful output:
>ref
TTTTTAGGGAAGATCTGGCCTTCCTACAAGGGAAGGCCAGGGAATTTTCTTCAGAGCAGA
>sampleid
TATTTAGGGAAGATCTGGCCTTCCTACAAGGGAAGGCCAGGGAATTTTCTTCAGAGCAGA
I used the sed -i '1h;2H;1,2d;4G' $i command to swap lines 2 and 4.
If I read it right, this should create the same result, though it would probably help a LOT if I could see what your input and expected output look like...
awk '{$0=$1}
FNR==1{hd=">"$0; next}
FNR==2{hd=hd"\n"$0;next}
FNR==3{print ">ref\n"$0 > FILENAME".fasta"}
FNR==4{next}
FNR==5{print hd"\n"$0 > FILENAME".fasta"}
' read_*
My input files:
$: cat read_x
foo x
bar x
baz x
last x
curiosity x
$: cat read_y
FOO y
BAR y
BAZ y
LAST y
CURIOSITY y
and the resulting output files:
$: cat read_x.fasta
>ref
baz
>foo
bar
curiosity
$: cat read_y.fasta
>ref
BAZ
>FOO
BAR
CURIOSITY
This runs in one pass with no loop aside from awk's usual internals, and leaves the originals in place so you can check it first. If all is good, all that's left is to remove the originals. For that, I would use extended globbing.
$: shopt -s extglob; rm read_!(*.fasta)
That will clean up the original inputs but not the new outputs.
Same results, three commands, no loops.
I am, or course, making some assumptions about what you are meaning to do that might not be accurate. To get this format in a single sed call -
$: sed -e 's/[[:space:]].*//' -e '1{s/^/>/;h;d}' -e '2{H;s/.*/>ref/}' -e '4x' read_x
>ref
baz
>foo
bar
curiosity
but that's not the same commands you used, so maybe I'm misreading it.
To use this to in-place edit multiple files at a time (instead of calling it in a loop on each file), use -si so that the line numbers apply to each file rather than the stream of records they collectively produce.
DON'T use -is, though you could use -i -s.
$: sed -s -i -e 's/[[:space:]].*//' -e '1{s/^/>/;h;d}' -e '2{H;s/.*/>ref/}' -e '4x' read_*
This still leaves you with the issue of renaming each, but xargs makes that pretty easy in the given example.
printf "%s\n" read_* | xargs -I# mv # #.fasta
addendum
Using the file you gave in the OP, assuming every file is the same general structure and exactly 4 lines -
$: cat file_0 # I made files 0 through 7, but with same data
sampleid 97 stuff 2086 42 213M = 3322 1431
TATTTAGGGAAGATCTGGCCTTCCTACAAGGGAAGGCCAGGGAATTTTCTTCAGAGCAGA
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
TTTTTAGGGAAGATCTGGCCTTCCTACAAGGGAAGGCCAGGGAATTTTCTTCAGAGCAGA
$: sed -Esi '1{s/^([^[:space:]]+).*/>\1/;h;s/.*/>ref/}; 3x;' file_?
$: cat file_0 # used a diff on each, worked on all at once
>ref
TATTTAGGGAAGATCTGGCCTTCCTACAAGGGAAGGCCAGGGAATTTTCTTCAGAGCAGA
>sampleid
TTTTTAGGGAAGATCTGGCCTTCCTACAAGGGAAGGCCAGGGAATTTTCTTCAGAGCAGA
Breakout:
-Esi Extended pattern matching, separate file linecounts, in-place edits
1{...}; Collectively do these commands, in order, only on every line 1
s/^([^[:space:]]+).*/>\1/ add leading > but strip everything after any whitespace
h store the resulting >\1 line in the hold buffer
s/.*/>ref/ then replace the whole line with a literal >ref
`3x' swap line 3 with the value in the hold buffer from line 1
file_? I used a glob to supply the appropriate list of files all at once.
Doing same with awk:
$: awk 'FNR==1{id=">"$1; print ">ref" >FILENAME".fasta"; next} FNR==3{print id > FILENAME".fasta"; next} {print $0 > FILENAME".fasta"}' file_?
Then you can do file management as above with the xargs/mv for the sed or the shopt/rm for the awk - or we could add a little organizational work in awk if you like. Consider this:
awk 'BEGIN { system(" mkdir -p done ") }
FNR==1 { id=">"$1; print ">ref" > FILENAME".fasta"; next } # skip printing original
FNR==3 { print id > FILENAME".fasta"; next } # skip printing original
{ print $0 > FILENAME".fasta" } # every line NOT skipped
FNR==4 { close(FILENAME); close(FILENAME".fasta");
system("mv " FILENAME " done/")
}' file_?
Then if there are any problems, it's easy to delete the fasta's, move the originals back, adjust the code, and try again. If everything is ok, it's fast and easy to rm -fr done, yes?
Note that I really only added the mkdir inside a system call in the awk to show that you can, and to keep from having to manually do it separately if you have to run a few iterations or move it all into a wrapper script, etc.
The code in the question runs multiple subprocesses (cut, sponge, sed four times, and mv) for each file that is processed. Running subprocesses is relatively slow, so you can speed up the code significantly by reducing the number of them.
This Shellcheck-clean code is one way to do it:
#! /bin/bash -p
old_files=()
for f in read_* ; do
readarray -t lines <"$f"
printf '>ref\n%s\n>%s\n%s\n' \
"${lines[3]}" "${lines[0]%%[[:space:]]*}" "${lines[1]}" >"$f.fasta"
old_files+=( "$f" )
done
rm -- "${old_files[#]}"
This runs no subprocesses when processing individual files. It just reads the lines of the old file into an array using the built-in readarray command and writes to the new file using the built-in printf.
See Removing part of a string (BashFAQ/100 (How do I do string manipulation in bash?)) for an explanation of the %% in ${lines[0]%%[[:space:]]*}.
To avoid running rm for each file, the code keeps a list of files to be deleted and removes all of them at the end. If you try the code, consider commenting the rm line until you are very confident that the rest of the code is doing what you want.
In the following example, I have a variable $line set to "14" which relates to the 14th line of the file which is "four".
I need to find a way in BASH to start at whichever line number is set in ($line) (14) and find the line number of the next occurrence of a string (foo) in the same file. In this case , the result would be line 16.
one
foo
bar
foo
two
foo
three
foo
foo
bar
foo
foo
foo
four
bar
foo
bar
five
foo
six
foo
foo
bar
foo
$line = "14"
$search = "foo"
Lots of ways to do this. But if you want to do it in bash alone (i.e. no awk, perl, etc), here's one way:
$ mapfile -t -O 1 a < ttt
$ for ((i=$line; i<=${#a[#]}; i++)); do [[ "${a[$i]}" = "$string" ]] && echo "$i" && break; done
The mapfile command sucks your file into an array (in a way that performs better than read in a loop), and the -O 1 causes it to start numbering array indices at 1 instead of 0. The for loop steps through the array, starting at $line, with a [[ that compares the current array value with $string.
I'd still love to see what solution you came up with, and help you understand why it didn't work.
Try awk:
line=14
search=foo
awk '(NR > n && $0 == s){ print NR; exit }' n=$line s="$search" file
Output:
16
You can assign the result to a variable this way:
declare -i var=$(awk '(NR > n && $0 == s){ print NR; exit }' n=$line s="$search" file)
sed one-liner -
Using your data, naming it "infile", I get
$: line=14 search=foo sed -n $line,\${/$search/\{=\;q}} infile
16
This sets variables for the env before executing sed, and tells it not to output anything unasked with -n.
the command $line,\${/$search/\{=\;q}} evaluates to 14,${/foo/{=;q}}
That means "from line 14 to the end, find the next line that has "foo" in it, and then
print the line number (=) and
quit (q) without processing the rest of the file.
I am new in bash scripting and I need help with awk. So the thing is that I have a property file with version inside and I want to update it.
version=1.1.1.0
and I use awk to do that
file="version.properties"
awk -F'["]' -v OFS='"' '/version=/{
split($4,a,".");
$4=a[1]"."a[2]"."a[3]"."a[4]+1
}
;1' $file > newFile && mv newFile $file
but I am getting strange result version="1.1.1.0""...1
Could someone help me please with this.
You mentioned in your comment you want to update the file in place. You can do that in a one-liner with perl:
perl -pe '/^version=/ and s/(\d+\.\d+\.\d+\.)(\d+)/$1 . ($2+1)/e' -i version.properties
Explanation
-e is followed by a script to run. With -p and -i, the effect is to run that script on each line, and modify the file in place if the script changes anything.
The script itself, broken down for explanation, is:
/^version=/ and # Do the following on lines starting with `version=`
s/ # Make a replacement on those lines
(\d+\.\d+\.\d+\.)(\d+)/ # Match x.y.z.w, and set $1 = `x.y.z.` and $2 = `w`
$1 . ($2+1)/ # Replace x.y.z.w with a copy of $1, followed by w+1
e # This tells Perl the replacement is Perl code rather
# than a text string.
Example run
$ cat foo.txt
version=1.1.1.2
$ perl -pe '/^version=/ and s/(\d+\.\d+\.\d+\.)(\d+)/$1 . ($2+1)/e' -i foo.txt
$ cat foo.txt
version=1.1.1.3
This is not the best way, but here's one fix.
Test case
I am assuming the input file has at least one line that is exactly version=1.1.1.0.
$ awk -F'["]' -v OFS='"' '/version=/{
> split($4,a,".");
> $4=a[1]"."a[2]"."a[3]"."a[4]+1
> }
> ;1' <<<'version=1.1.1.0'
Output:
version=1.1.1.0"""...1
The """ is because you are assigning to field 4 ($4). When you do that, awk adds field separators (OFS) between fields 1 and 2, 2 and 3, and 3 and 4. Three OFS => """, in your example.
Minimal change
$ awk -F'["]' -v OFS='"' '/version=/{
split($1,a,".");
$1=a[1]"."a[2]"."a[3]"."a[4]+1;
print
}
' <<<'version=1.1.1.0'
version=1.1.1.1
Two changes:
Change $4 to $1
Since the input field separator (-F) is ["], $4 is whatever would be after the third " (if there were any in the input). Therefore, split($4, ...) splits an empty field. The contents of the line, before the first " (if any), are in $1.
print at the end instead of ;1
The 1 after the closing curly brace is the next condition, and there is no action specified. The default action is to print the current line, as modified, so the 1 triggers printing. Instead, just print within your action when you are done processing. That way your action is self-contained. (Of course, if you needed to do other processing, you might want to print later, after that processing.)
You can use the = as the delimiter, like this:
awk -F= -v v=1.0.1 '$1=="version"{printf "version=\"%s\"\n", v}' file.properties
I am creating a bash script to modify and summarize information with grep and sed. But it gets stuck.
#!/bin/bash
# This script extracts some basic information
# from text files and prints it to screen.
#
# Usage: ./myscript.sh </path/to/text-file>
#Extract lines starting with ">#HWI"
ONLY=`grep -v ^\>#HWI`
#replaces A and G with R in lines
ONLYR=`sed -e s/A/R/g -e s/G/R/g $ONLY`
grep R $ONLYR | wc -l
The correct way to write a shell script to do what you seem to be trying to do is:
awk '
!/^>#HWI/ {
gsub(/[AG]/,"R")
if (/R/) {
++cnt
}
END { print cnt+0 }
' "$#"
Just put that in the file myscript.sh and execute it as you do today.
To be clear - the bulk of the above code is an awk script, the shell script part is the first and last lines where the shell just calls awk and passes it the input file names.
If you WANT to have intermediate variables then you can create/print them with:
awk '
!/^>#HWI/ {
only = $0
onlyR = only
gsub(/[AG]/,"R",onlyR)
print "only:", only
print "onlyR:", onlyR
if (/R/) {
++cnt
}
END { print cnt+0 }
' "$#"
The above will work robustly, portably, and efficiently on all UNIX systems.
First of all, and as #fedorqui commented - you're not providing grep with a source of input, against which it will perform line matching.
Second, there are some problems in your script, which will result in unwanted behavior in the future, when you decide to manipulate some data:
Store matching lines in an array, or a file from which you'll later read values. The variable ONLY is not the right data structure for the task.
By convention, environment variables (PATH, EDITOR, SHELL, ...) and internal shell variables (BASH_VERSION, RANDOM, ...) are fully capitalized. All other variable names should be lowercase. Since
variable names are case-sensitive, this convention avoids accidentally overriding environmental and internal variables.
Here's a better version of your script, considering these points, but with an open question regarding what you were trying to do in the last line : grep R $ONLYR | wc -l :
#!/bin/bash
# This script extracts some basic information
# from text files and prints it to screen.
#
# Usage: ./myscript.sh </path/to/text-file>
input_file=$1
# Read lines not matching the provided regex, from $input_file
mapfile -t only < <(grep -v '^\>#HWI' "$input_file")
#replaces A and G with R in lines
for((i=0;i<${#only[#]};i++)); do
only[i]="${only[i]//[AG]/R}"
done
# DEBUG
printf '%s\n' "Here are the lines, after relpace:"
printf '%s\n' "${only[#]}"
# I'm not sure what you were trying to do here. Am I gueesing right that you wanted
# to count the number of R's in ALL lines ?
# grep R $ONLYR | wc -l
I am working with a script which looks for file lines after a specific line and process them to get data from it.
Let me illustrate with an example,
if file "sample.log" has lines like
qwerty asdf foo bar
foo
time: 1:00 PM
foo1 bar1
foo foo fooo copying file abc/def/ghi/foo.txt
bar bar1 bar2 copying file efg/qwe/bar.txt
foo
My script should search for contents after time: 1:00 PM. After finding those lines, it must look for lines matching the pattern "copying" and get the path specified in the line.
In this case, output written to another file should be
abc/def/ghi/foo.txt
efg/qwe/bar.txt
I tried this using following command but getting empty string as output. Please guide me with this
sed -n '/^time: 1:00 PM/{/^(.*)copying file/s/^(.*)copying file //p}' ../../sample.log
If you're already in Tcl, you could code it in Tcl:
set fid [open "FILE" r]
set have_time false
while {[gets $fid line] != -1} {
if {$have_time && [regexp {copying file (.*)} $line -> filename]} {
puts $filename
} elseif {[string first "time:" $line] > -1} {
set have_time true
}
}
close $fid
If your file is quite huge, exec sed may be faster, but you'll have to see for yourself.
Note, if you're going to exec sed, keep in mind that inside Tcl, single quotes have no special meaning: use braces to quote the sed program.
exec sed -e {do stuff here} FILE
sed '/1:00 PM/,$ {/copying/s:.*file \(.*\):\1:p};d' FILE
This might work for you (GNU sed):
sed -ne '/1:00 PM/,$!b' -e 's/.*copying.* //w copy' file