I have a script running to use output from commands that I run using a string from the file that I want to update.
for CLIENT in `cat /home/"$ID"/file.txt | awk '{print $3}'`
do
sed "/$CLIENT/ s/$/ $(sudo bpgetconfig -g $CLIENT -L | grep -i "version name")/" /home/"$ID"/file.txt >> /home/"$ID"/updated_file.txt
done
The output prints out the entire file once for each line with the matching line in question updated.
How do I sort it so that it only sends the matching line to the new file.
The input file contains lines similar to below:
"Host OS" "OS Version" "Hostname"
I want to run a script that will use the hostname to run a command and grab details about an application on the host and then print only the application version to the end of the line with the host in it:
"Host OS" "OS Version" "Hostname" "Application Version
What you're doing is very fragile (e.g. it'll break if the string represented by $CLIENT appears on other lines or multiple times on 1 line or as substrings or contains regexp metachars or...) and inefficient (you're reading file.txt one per iteration of the loop instead of once total) and employing anti-patterns (e.g. using a for loop to read lines of input, plus the UUOC, plus deprecated backticks, etc.)
Instead, let's say the command you wanted to run was printf '%s' 'the_third_string' | wc -c to replace each third string with the count of its characters. Then you'd do:
while read -r a b c rest; do
printf '%s %s %s %s\n' "$a" "$b" "$(printf '%s' "$c" | wc -c)" "$rest"
done < file
or if you had more to do and so it was worth using awk:
awk '{
cmd = "printf \047%s\047 \047" $3 "\047 | wc -c"
if ( (cmd | getline line) > 0 ) {
$3 = line
}
close(cmd)
print
}' file
For example given this input (courtesy of Rabbie Burns):
When chapman billies leave the street,
And drouthy neibors, neibors, meet;
As market days are wearing late,
And folk begin to tak the gate,
While we sit bousing at the nappy,
An' getting fou and unco happy,
We think na on the lang Scots miles,
The mosses, waters, slaps and stiles,
That lie between us and our hame,
Where sits our sulky, sullen dame,
Gathering her brows like gathering storm,
Nursing her wrath to keep it warm.
We get:
$ awk '{cmd="printf \047%s\047 \047"$3"\047 | wc -c"; if ( (cmd | getline line) > 0 ) $3=line; close(cmd)} 1' file
When chapman 7 leave the street,
And drouthy 8 neibors, meet;
As market 4 are wearing late,
And folk 5 to tak the gate,
While we 3 bousing at the nappy,
An' getting 3 and unco happy,
We think 2 on the lang Scots miles,
The mosses, 7 slaps and stiles,
That lie 7 us and our hame,
Where sits 3 sulky, sullen dame,
Gathering her 5 like gathering storm,
Nursing her 5 to keep it warm.
The immediate answer is to use sed -n to not print every line by default, and add a p command where you do want to print. But running sed in a loop is nearly always the wrong thing to do.
The following avoids the useless cat, the don't read lines with for antipattern, the obsolescent backticks, and the loop; but without knowledge of what your files look like, it's rather speculative. In particular, does command need to run for every match separately?
file=/home/"$ID"/file.txt
pat=$(awk '{ printf "\\|$3"}' "$file")
sed -n "/${pat#\\|}/ s/$/ $(command)/p' "$file" >> /home/"$ID"/updated_file.txt
The main beef here is collecting all the patterns we want to match into a single regex, and then running sed only once.
If command needs to be run uniquely for each line, this will not work out of the box. Maybe then turn back to a loop after all. If your task is actually to just run a command for each line in the file, try
while read -r line; do
# set -- $line
# client=$3
printf "%s " "$line"
command
done <file >>new_file
I included but commented out commands to extract the third field into $client before you run command.
(Your private variables should not have all-uppercase names; those are reserved for system variables.)
Perhaps in fact this is all you need:
while read -r os osver host; do
printf "%s " "$os" "$osver" "$host"
command "$host" something something
done </home/"$ID"/file.txt >/home/"$ID"/updated_file.txt
This assumes that the output of command is a well-formed single line of output with a final newline.
This might work for you (GNU sed, bash/dash):
echo "command () { expr length \"\$1\"; }" >> funlib
sed -E 's/^((\S+\s){2})(\S+)(.*)/. .\/funlib; echo "\1$(command "\3")\4"/e' file
As an example of a command, I create a function called command and append it to a file funlib in the current directory.
The sed invocation, sources the funlib and runs the command function in the RHS of the substitution command within an interpolation of string, displayed by the echo command which is made possible by the evaluation flag e.
N.B. The evaluation uses the dash shell or whatever the /bin/sh is symlinked to.
Related
I have a text file which looks like this
1
bbbbb
aaa
END
2
ttttt
mmmm
uu
END
3
....
END
The number of lines between the single number patterns (1,2,3) and END is variable. So the upper delimiting pattern changes, but the final one does not. Using some bash commands, I would like to grep lines between a specified upper partner and the corresponding END, for example a command that takes as input 2 and returns
2
ttttt
mmmm
uu
END
I've tried various solutions with sed and awk, but still can't figure it out. The main problem is that I may need to grep a entry in the middle of the file, so I can't use sed with /pattern/q...Any help will be greatly appreciated!
With awk we set a flag f when matching the start pattern, which is an input argument. After that row, the flag is on and it prints every line. When reaching "END" (AND the flag is on!) it exits.
awk -v p=2 '$0~p{f=1} f{print} f&&/END/{exit}' file
Use sed and its addresses to only print a part of the file between the patterns:
#!/bin/bash
start=x
while [[ $start = *[^0-9]* ]] ; do
read -p 'Enter the start pattern: ' start
done
sed -n "/^$start$/,/^END$/p" file
You can use the sed with an address range. Modify the first regular expression (RE1) in /RE1/,/RE2/ as your convenience:
sed -n '/^[[:space:]]*2$/,/^[[:space:]]*END$/p' file
Or,
sed '
/^[[:space:]]*2$/,/^[[:space:]]*END$/!d
/^[[:space:]]*END$/q
' file
This quits upon reading the END, thus may be more efficient.
Another option/solution using just bash
#!/usr/bin/env bash
start=$1
while IFS= read -r lines; do
if [[ ${lines##* } == $start ]]; then
print=on
elif [[ ${lines##* } == [0-9] ]]; then
print=off
fi
case $print in on) printf '%s\n' "$lines";; esac
done < file.txt
Run the script with the number as the argument, 1 can 2 or 3 or ...
./myscript 1
This might work for you (GNU sed):
sed -n '/^\s*2$/{:a;N;/^\s*END$/M!ba;p;q}' file
Switch off implicit printing by setting the -n option.
Gather up the lines beginning with a line starting with 2 and ending in a line starting with END, print the collection and quit.
N.B. The second regexp uses the M flag, which allows the ^ and $ to match start and end of lines when multiple lines are being matched. Another thing to bear in mind is that using a range i.e. sed -n '/start/,/end/p' file, will start printing lines the moment the first condition is met and if the second match does not materialise, it will continue printing to the end of the file.
I have a file with 2 columns, and i want to use the values from the second column to set the range in the cut command to select a range of characters from another file. The range i desire is the character in the position of the value in the second column plus the next 10 characters. I will give an example in a while.
My files are something like that:
File with 2 columns and no blank lines between lines (file1.txt):
NAME1 10
NAME2 25
NAME3 48
NAME4 66
File that i want to extract the variable range of characters(just one very long line with no spaces and no bold font) (file2.txt):
GATCGAGCGGGATTCTTTTTTTTTAGGCGAGTCAGCTAGCATCAGCTACGAGAGGCGAGGGCGGGCTATCACGACTACGACTACGACTACAGCATCAGCATCAGCGCACTAGAGCGAGGCTAGCTAGCTACGACTACGATCAGCATCGCACATCGACTACGATCAGCATCAGCTACGCATCGAAGAGAGAGC
...or, more literally (for copy/paste to test):
GATCGAGCGGGATTCTTTTTTTTTAGGCGAGTCAGCTAGCATCAGCTACGAGAGGCGAGGGCGGGCTATCACGACTACGACTACGACTACAGCATCAGCATCAGCGCACTAGAGCGAGGCTAGCTAGCTACGACTACGATCAGCATCGCACATCGACTACGATCAGCATCAGCTACGCATCGAAGAGAGAGC
Desired resulting file, one sequence per line (result.txt):
GATTCTTTTT
GGCGAGTCAG
CGAGAGGCGA
TATCACGACT
The resulting file would have the characters from 10-20, 25-35, 48-58 and 66-76, each range in a new line. So, it would always keep the range of 10, but in different start points and those start points are set by the values in the second column from the first file.
I tried the command:
for i in $(awk '{print $2}' file1.txt);
do
p1=$i;
p2=`expr "$1" + 10`
cut -c$p1-$2 file2.txt > result.txt;
done
I don't get any output or error message.
I also tried:
while read line; do
set $line
p2=`expr "$2" + 10`
cut -c$2-$p2 file2.txt > result.txt;
done <file1.txt
This last command gives me an error message:
cut: invalid range with no endpoint: -
Try 'cut --help' for more information.
expr: non-integer argument
There's no need for cut here; dd can do the job of indexing into a file, and reading only the number of bytes you want. (Note that status=none is a GNUism; you may need to leave it out on other platforms and redirect stderr otherwise if you want to suppress informational logging).
while read -r name index _; do
dd if=file2.txt bs=1 skip="$index" count=10 status=none
printf '\n'
done <file1.txt >result.txt
This approach avoids excessive memory requirements (as present when reading the whole of file2 -- assuming it's large), and has bounded performance requirements (overhead is equal to starting one copy of dd per sequence to extract).
Using awk
$ awk 'FNR==NR{a=$0; next} {print substr(a,$2+1,10)}' file2 file1
GATTCTTTTT
GGCGAGTCAG
CGAGAGGCGA
TATCACGACT
If file2.txt is not too large, then you can read it in memory,
and use Bash sub-strings to extract the desired ranges:
data=$(<file2.txt)
while read -r name index _; do
echo "${data:$index:10}"
done <file1.txt >result.txt
This will be much more efficient than running cut or another process for every single range definition.
(Thanks to #CharlesDuffy for the tip to read data without a useless cat, and the while loop.)
One way to solve it:
#!/bin/bash
while read line; do
pos=$(echo "$line" | cut -f2 -d' ')
x=$(head -c $(( $pos + 10 )) file2.txt | tail -c 10)
echo "$x"
done < file1.txt > result.txt
It's not the solution an experienced bash hacker would use, but it is very good for someone who is new to bash. It uses tools that are very versatile, although somewhat bad if you need high performance. Shell scripting is commonly used by people who rarely shell scripts, but knows a few commands and just wants to get the job done. That's why I'm including this solution, even if the other answers are superior for more experienced people.
The first line is pretty easy. It just extracts the numbers from file1.txt. The second line uses the very nice tools head and tail. Usually, they are used with lines instead of characters. Nevertheless, I print the first pos + 10 characters with head. The result is piped into tail which prints the last 10 characters.
Thanks to #CharlesDuffy for improvements.
I have made a script to practice my Bash, only to realize that this script does not take tabulation into account, which is a problem since it is designed to find and replace a pattern in a Python script (which obviously needs tabulation to work).
Here is my code. Is there a simple way to get around this problem ?
pressure=1
nline=$(cat /myfile.py | wc -l) # find the line length of the file
echo $nline
for ((c=0;c<=${nline};c++))
do
res=$( tail -n $(($(($nline+1))-$c)) myfile.py | head -n 1 | awk 'gsub("="," ",$1){print $1}' | awk '{print$1}')
#echo $res
if [ $res == 'pressure_run' ]
then
echo "pressure_run='${pressure}'" >> myfile_mod.py
else
echo $( tail -n $(($nline-$c)) myfile.py | head -n 1) >> myfile_mod.py
fi
done
Basically, it finds the line that has pressure_run=something and replaces it by pressure_run=$pressure. The rest of the file should be untouched. But in this case, all tabulation is deleted.
If you want to just do the replacement as quickly as possible, sed is the way to go as pointed out in shellter's comment:
sed "s/\(pressure_run=\).*/\1$pressure/" myfile.py
For Bash training, as you say, you may want to loop manually over your file. A few remarks for your current version:
Is /myfile.py really in the root directory? Later, you don't refer to it at that location.
cat ... | wc -l is a useless use of cat and better written as wc -l < myfile.py.
Your for loop is executed one more time than you have lines.
To get the next line, you do "show me all lines, but counting from the back, don't show me c lines, and then show me the first line of these". There must be a simpler way, right?
To get what's the left-hand side of an assignment, you say "in the first space-separated field, replace = with a space , then show my the first space separated field of the result". There must be a simpler way, right? This is, by the way, where you strip out the leading tabs (your first awk command does it).
To print the unchanged line, you do the same complicated thing as before.
A band-aid solution
A minimal change that would get you the result you want would be to modify the awk command: instead of
awk 'gsub("="," ",$1){print $1}' | awk '{print$1}'
you could use
awk -F '=' '{ print $1 }'
"Fields are separated by =; give me the first one". This preserves leading tabs.
The replacements have to be adjusted a little bit as well; you now want to match something that ends in pressure_run:
if [[ $res == *pressure_run ]]
I've used the more flexible [[ ]] instead of [ ] and added a * to pressure_run (which must not be quoted): "if $res ends in pressure_run, then..."
The replacement has to use $res, which has the proper amount of tabs:
echo "$res='${pressure}'" >> myfile_mod.py
Instead of appending each line each loop (and opening the file each time), you could just redirect output of your whole loop with done > myfile_mod.py.
This prints literally ${pressure} as in your version, because it's single quoted. If you want to replace that by the value of $pressure, you have to remove the single quotes (and the braces aren't needed here, but don't hurt):
echo "$res=$pressure" >> myfile_mod.py
This fixes your example, but it should be pointed out that enumerating lines and then getting one at a time with tail | head is a really bad idea. You traverse the file for every single line twice, it's very error prone and hard to read. (Thanks to tripleee for suggesting to mention this more clearly.)
A proper solution
This all being said, there are preferred ways of doing what you did. You essentially loop over a file, and if a line matches pressure_run=, you want to replace what's on the right-hand side with $pressure (or the value of that variable). Here is how I would do it:
#!/bin/bash
pressure=1
# Regular expression to match lines we want to change
re='^[[:space:]]*pressure_run='
# Read lines from myfile.py
while IFS= read -r line; do
# If the line matches the regular expression
if [[ $line =~ $re ]]; then
# Print what we matched (with whitespace!), then the value of $pressure
line="${BASH_REMATCH[0]}"$pressure
fi
# Print the (potentially modified) line
echo "$line"
# Read from myfile.py, write to myfile_mod.py
done < myfile.py > myfile_mod.py
For a test file that looks like
blah
test
pressure_run=no_tab
blah
something
pressure_run=one_tab
pressure_run=two_tabs
the result is
blah
test
pressure_run=1
blah
something
pressure_run=1
pressure_run=1
Recommended reading
How to read a file line-by-line (explains the IFS= and -r business, which is quite essential to preserve whitespace)
BashGuide
This question already has answers here:
How to get the part of a file after the first line that matches a regular expression
(12 answers)
Closed 7 years ago.
I have a file that contains a list of URLs. It looks like below:
file1:
http://www.google.com
http://www.bing.com
http://www.yahoo.com
http://www.baidu.com
http://www.yandex.com
....
I want to get all the records after: http://www.yahoo.com, results looks like below:
file2:
http://www.baidu.com
http://www.yandex.com
....
I know that I could use grep to find the line number of where yahoo.com lies using
grep -n 'http://www.yahoo.com' file1
3 http://www.yahoo.com
But I don't know how to get the file after line number 3. Also, I know there is a flag in grep -A print the lines after your match. However, you need to specify how many lines you want after the match. I am wondering is there something to get around that issue. Like:
Pseudocode:
grep -n 'http://www.yahoo.com' -A all file1 > file2
I know we could use the line number I got and wc -l to get the number of lines after yahoo.com, however... it feels pretty lame.
AWK
If you don't mind using AWK:
awk '/yahoo/{y=1;next}y' data.txt
This script has two parts:
/yahoo/ { y = 1; next }
y
The first part states that if we encounter a line with yahoo, we set the variable y=1, and then skip that line (the next command will jump to the next line, thus skip any further processing on the current line). Without the next command, the line yahoo will be printed.
The second part is a short hand for:
y != 0 { print }
Which means, for each line, if variable y is non-zero, we print that line. In AWK, if you refer to a variable, that variable will be created and is either zero or empty string, depending on context. Before encounter yahoo, variable y is 0, so the script does not print anything. After encounter yahoo, y is 1, so every line after that will be printed.
Sed
Or, using sed, the following will delete everything up to and including the line with yahoo:
sed '1,/yahoo/d' data.txt
This is much easier done with sed than grep. sed can apply any of its one-letter commands to an inclusive range of lines; the general syntax for this is
START , STOP COMMAND
except without any spaces. START and STOP can each be a number (meaning "line number N", starting from 1); a dollar sign (meaning "the end of the file"), or a regexp enclosed in slashes, meaning "the first line that matches this regexp". (The exact rules are slightly more complicated; the GNU sed manual has more detail.)
So, you can do what you want like so:
sed -n -e '/http:\/\/www\.yahoo\.com/,$p' file1 > file2
The -n means "don't print anything unless specifically told to", and the -e directive means "from the first appearance of a line that matches the regexp /http:\/\/www\.yahoo\.com/ to the end of the file, print."
This will include the line with http://www.yahoo.com/ on it in the output. If you want everything after that point but not that line itself, the easiest way to do that is to invert the operation:
sed -e '1,/http:\/\/www\.yahoo\.com/d' file1 > file2
which means "for line 1 through the first line matching the regexp /http:\/\/www\.yahoo\.com/, delete the line" (and then, implicitly, print everything else; note that -n is not used this time).
awk '/yahoo/ ? c++ : c' file1
Or golfed
awk '/yahoo/?c++:c' file1
Result
http://www.baidu.com
http://www.yandex.com
This is most easily done in Perl:
perl -ne 'print unless 1 .. m(http://www\.yahoo\.com)' file
In other words, print all lines that aren’t between line 1 and the first occurrence of that pattern.
Using this script:
# Get index of the "yahoo" word
index=`grep -n "yahoo" filepath | cut -d':' -f1`
# Get the total number of lines in the file
totallines=`wc -l filepath | cut -d' ' -f1`
# Subtract totallines with index
result=`expr $total - $index`
# Gives the desired output
grep -A $result "yahoo" filepath
I have a script which uses grep to find lines in a text file (ics calendar to be specific)
My script finds a date match, then goes up and down a few lines to copy the summary and start time of the appointment into a separate variable. The problem I have is that I'm going to have multiple appointments at the same time, and I need to run through the whole process for each result in grep.
Example:
LINE=`grep -F -n 20130304T232200 /path/to/calendar.ics | cut -f1 d:`
And it outputs only the lines, such as
86 89
Then it goes on to capture my other variables, as such:
SUMMARYLINE=$(( $LINE + 5 ))
SUMMARY:`sed -n "$SUMMARYLINE"p /path/to/calendar.ics
my script runs fine with one output, but it obviously won't work with more than 1 and I need for it to. should I send the grep results into an array? a separate text file to read from? I'm sure I'll need a while loop in here somehow. Need some help please.
You can call grep from a loop quite easily:
while IFS=':' read -r LINE notused # avoids the use of cut
do
# First field is now in $LINE
# Further processing
done < <(grep -F -n 20130304T232200 /path/to/calendar.ics)
However, if the file is not too large then it might be easier to read the whole file into an array and more around that.
With your proposed solution, you are reading through the file several times. Using awk, you can do it in one pass:
awk -F: -v time=20130304T232200 '
$1 == "SUMMARY" {summary = substr($0,9)}
/^DTSTART/ {start = $2}
/^END:VEVENT/ && start == time {print summary}
' calendar.ics