Replace single character in fasta header with awk or sed - bash

Question

I am working in bash with a fasta file with headers that begin with a ">" and end with either a "C" or a "+". Like so:
>chr1:35031657-35037706+
GGTGGACTAGCCAGTGAATGTCAACGCGTCCCTA
CCTAAGGCGATATCCGCAGCCGCCCGCGTCCCTA
>chr1:71979382-71985425C
agattaaatgaactattacacataaagtgcttac
ttacacataaagtgcttacgaactattacaggga
I'd like to use awk (gsub?) or sed to change the last character of the header to a "+" if it is a "C". Basically I want all of the sequences to end in "+". No C's.
Desired output:
>chr1:35031657-35037706+
GGTGGACTAGCCAGTGAATGTCAACGCGTCCCTA
CCTAAGGCGATATCCGCAGCCGCCCGCGTCCCTA
>chr1:71979382-71985425+
agattaaatgaactattacacataaagtgcttac
ttacacataaagtgcttacgaactattacaggga
Nothing needs to change with the sequences. I think this is pretty straight forward, but I'm struggling to use other posts to do this myself. I know that awk '/^>/ && /C$/{print $0}' will print the headers than begin with ">" and end with "C", but I'm not sure how to replace all of those "C"s with "+"s.
Thanks for your help!

Answer 1

I think this would be easier to do in sed:
sed '/^>/ s/C$/+/'
Translation: on lines starting with ">", replace "C" at the end of the line with "+". Note that if the "C" isn't matched, there isn't an error, it just doesn't replace anything. Also, unlike awk, sed automatically prints each line after processing it.
If you really want to use awk, the equivalent would be:
awk '/^>/ {sub("C$","+",$0)}; {print}'

Answer 2

Use this Perl one-liner:
perl -pe 's{^(>.*)C$}{$1+}' input.fasta > output.fasta
Or, to change the file in-place:
perl -i.bak -pe 's{^(>.*)C$}{$1+}' input.fasta
The Perl one-liner uses these command line flags:
-e : Tells Perl to look for code in-line, instead of in a file.
-p : Loop over the input one line at a time, assigning it to $_ by default. Add print $_ after each loop iteration.
-i.bak : Edit input files in-place (overwrite the input file). Before overwriting, save a backup copy of the original file by appending to its name the extension .bak. If you want to skip writing a backup file, just use -i and skip the extension.
s{^(>.*)C$}{$1+} : Change the line that starts with > (= fasta header) and ends with C to the same line with C changed to +.
^ marks the beginning of the line and $ marks the end of the line. .* means any character repeated 0 or more times. (>.*) captures the pattern inside, which is the entire line minus the C, and stores it in capture variable $1.
SEE ALSO:
perldoc perlrun: how to execute the Perl interpreter: command line switches
perldoc perlre: Perl regular expressions (regexes)
perldoc perlre: Perl regular expressions (regexes): Quantifiers; Character Classes and other Special Escapes; Assertions; Capture groups
perldoc perlrequick: Perl regular expressions quick start

Answer 3

You might harness GNU AWK for this task following way, let file.txt content be
>chr1:35031657-35037706+
GGTGGACTAGCCAGTGAATGTCAACGCGTCCCTA
CCTAAGGCGATATCCGCAGCCGCCCGCGTCCCTA
>chr1:71979382-71985425C
agattaaatgaactattacacataaagtgcttac
ttacacataaagtgcttacgaactattacaggga
then
awk 'BEGIN{FPAT=".";OFS=""}$1==">"{$NF="+"}{print}' file.txt
gives output
>chr1:35031657-35037706+
GGTGGACTAGCCAGTGAATGTCAACGCGTCCCTA
CCTAAGGCGATATCCGCAGCCGCCCGCGTCCCTA
>chr1:71979382-71985425+
agattaaatgaactattacacataaagtgcttac
ttacacataaagtgcttacgaactattacaggga
Explanation: I inform GNU AWK that field is any single character using FPAT and output field separator is empty string using OFS. For each line where 1st field, that is 1st character is > I change value of last field ($NF) to +. Note this is applied also to headers ending with + but this is not problem as it changes + to +. Each line, changed or not, is printed.
(tested in GNU Awk 5.0.1)