Given a query string Q of length N, and a list L of M sequences of length exactly N, what is the most efficient algorithm to find the string in L with the fewest mismatch positions to Q? For example:
Q = "ABCDEFG";
L = ["ABCCEFG", "AAAAAAA", "TTAGGGT", "ZYXWVUT"];
answer = L.query(Q); # Returns "ABCCEFG"
answer2 = L.query("AAAATAA"); #Returns "AAAAAAA".
The obvious way is to scan every sequence in L, making the search take O(M * N). Is there any way to do this in sublinear time? I don't care if there's a large upfront cost to organizing L into some data structure because it will be queried a lot of times. Also, handling tied scores arbitrarily is fine.
Edit: To clarify, I am looking for the Hamming distance.
All the answers except the one that mentions the best first algorithm are very much off.
Locally sensitive hashing is basically dreaming. This is the first time I see answers so much off on stackoverflow.
First, this is a hard, but standard problem that has been solved many years ago
in different ways.
One approach uses a trie such as the one preseted
by Sedgewick here:
http://www.cs.princeton.edu/~rs/strings/
Sedgewick also has sample C code.
I quote from the paper titled "Fast Algorithms for Sorting and Searching Strings" by Bentley and Sedgewick:
"‘‘Near neighbor’’ queries locate all words within a given Hamming distance
of a query word (for instance, code is distance 2 from soda). We give a new algorithm for near neighbor searching in strings, present a simple C implementation, and describe experiments on its efficiency."
A second approach is to use indexing. Split the strings into characters n-grams and index
with inverted index (google for Lucene spell checker to see how it's done).
Use the index to pull potential candidates and then run hamming distance or edit distnace on the candidates. This is the approach guaranteed to work best (and relatively simple).
A third appears in the area of speech recognition. There the query is a wav signal, and the database is a set of strings. There is a "table" that matches pieces of the signal to pieces of words. The goal is to find the best match of words to signal. This problem is known as word alignment.
In the problem posted, there is an implicit cost of matching query parts to database parts.
For example one may have different costs for deletion/insertion/substitution and even
different costs for mismatching say "ph" with "f".
The standard solution in speech recognition uses a dynamic programming approach which is made efficient via heuristics that direct pruning. In this way, only the best, say 50 candidates are kept. Thus, the name best-first search. In theory, you may not get the best match, but usually one gets a good match.
Here is a reference to the latter approach:
http://amta2010.amtaweb.org/AMTA/papers/2-02-KoehnSenellart.pdf
Fast Approximate String Matching with Suffix Arrays and A* Parsing.
This approach applies not only to words but to sentences.
Locality sensitive hashing underlies what seems to be the asymptotically best method known, as I understand it from this review article in CACM. Said article is pretty hairy and I didn't read it all. See also nearest neighbor search.
To relate these references to your problem: they all deal with a set of points in a metric space, such as an n-dimensional vector space. In your problem, n is the length of each string, and the values on each coordinate are the characters that can appear at each position in a string.
The "best" method will vary significantly depending on your input set and query set. Having a fixed message length will let you treat this problem in a classification context.
An information theoretic decision tree algorithm (like C4.5, for example) will provide the best overall guarantee on performance. In order to get optimal performance out of this method, you must first cluster the string indices into features based on mutual information. Note that you will need to modify the classifier to return all leaf nodes at the last branch, then compute a partial edit distance for each of them. The edit distance only needs to be calculated for the feature set represented by the last split of the tree.
Using this technique, querying should be ~ O(k log n), k << m, where k is the expectation of the feature size, m is the length of the string, and n is the number of comparison sequences.
The initial setup on this is guaranteed to be less than O(m^2 + n*t^2), t < m, t * k ~ m, where t is the feature count for an item. This is very reasonable and should not require any serious hardware.
These very nice performance numbers are possible because of the fixed m constraint. Enjoy!
I think you are looking for the Levenshtein edit distance.
There are a few questions here on SO about this already, I suppose you can find some good answers.
You could treat each sequence as an N-dimensional coordinate, chunk the resulting space into blocks that know what sequences occur in them, then on a lookup first search the search sequence's block and all contiguous blocks, then expand outward as necessary. (Maintaining several scopes of chunking is probably more desirable than getting into searching really large groups of blocks.)
Are you looking for the Hamming distance between the strings (i.e. the number of different characters at equivalent locations)?
Or does the distance "between" characters (e.g. difference between ASCII values of English letters) matter to you as well?
Some variety of best-first search on the target sequences will do much better than O(M * N). The basic idea of this is that you'd compare the first character in your candidate sequence with the first character of the target sequences, then in your second iteration only do the next-character comparison with the sequences that have the least number of mismatches, and so on. In your first example, you'd wind up comparing against ABCCEFG and AAAAAAA the second time, ABCCEFG only the third and fourth times, all the sequences the fifth time, and only ABCCEFG thereafter. When you get to the end of your candidate sequence, the set of target sequences with the lowest mismatch count is your match set.
(Note: at each step you're comparing against the next character for that branch of the search. None of the progressive comparisons skip characters.)
I can't think of a general, exact algorithm which will be less than O(N * M), but if you have a small enough M and N you can make an algorithm which performs as (N + M) using bit-parallel operations.
For example, if N and M are both less than 16, you could use a N * M lookup table of 64 bit ints ( 16*log2(16) = 64), and perform all operations in one pass through the string, where each group of 4 bits in the counter counts 0-15 for one of the string being matched. Obviously you need M log2(N+1) bits to store the counters, so might need to update multiple values for each character, but often a single pass lookup can be faster than other approaches. So it's actually O( N * M log(N) ), just with a lower constant factor - using 64 bit ints introduces a 1/64 into it, so should be better if log2(N) < 64. If M log2(N+1) < 64, it works out as (N+M) operations. But that's still linear, rather than sub-linear.
#include <stdint.h>
#include <stdlib.h>
#include <stdio.h>
#include <inttypes.h>
size_t match ( const char* string, uint64_t table[][128] ) ;
int main ()
{
const char* data[] = { "ABCCEFG", "AAAAAAA", "TTAGGGT", "ZYXWVUT" };
const size_t N = 7;
const size_t M = 4;
// prepare a table
uint64_t table[7][128] = { 0 };
for ( size_t i = 0; i < M; ++i )
for ( size_t j = 0; j < N; ++j )
table[j][ (size_t)data[i][j] ] |= 1 << (i * 4);
const char* examples[] = { "ABCDEFG", "AAAATAA", "TTAGQQT", "ZAAGVUT" };
for ( size_t i = 0; i < 4; ++i ) {
const char* q = examples[i];
size_t result = match ( q, table );
printf("Q(%s) -> %zd %s\n", q, result, data[result]);
}
}
size_t match ( const char* string, uint64_t table[][128] )
{
uint64_t count = 0;
// scan through string once, updating all counters at once
for ( size_t i = 0; string[i]; ++i )
count += table[i][ (size_t) string[i] ];
// find greatest sub-count within count
size_t best = 0;
size_t best_sub_count = count & 0xf;
for ( size_t i = 1; i < 4; ++i ) {
size_t sub_count = ( count >>= 4 ) & 0xf;
if ( sub_count > best_sub_count ) {
best_sub_count = sub_count;
best = i;
}
}
return best;
}
Sorry for bumping this old thread
To search elementwise would mean a complexity of O(M*N*N) - O(M) for searching and O(N*N) for calculating levenshtein distance.
The OP is looking for an efficient way to find the smallest hamming distance (c), not the string itself. If you have an upper bound on c (say X), you can find the smallest c in O(log(X)*M*N).
As Stefan pointed out, you can quickly find strings within a given hamming distance. This page http://blog.faroo.com/2015/03/24/fast-approximate-string-matching-with-large-edit-distances/ talks about one such way using Tries. Modify this to just test if there is such a string and binary search on c from 0 to X.
If up front cost don't matter you could calculate the best match for every possible input, and put the result in a hash map.
Of course this won't work if N isn't exremely small.
Related
I would like to use backtracking to search for all substrings in a long string allowing for variable length matches - that is matches allowing for a maximum given number of mismatches, insertions, and deletions. I have not been able to locate any useful examples. The closest I have found is this paper here, but that is terribly complex. Anyone?
Cheers,
Martin
Algorithm
The function ff() below uses recursion (i.e. backtracking) to solve your problem. The basic idea is that at the start of any call to f(), we are trying to match a suffix t of the original "needle" string to a suffix s of the "haystack" string, while allowing only a certain number of each type of edit operation.
// ss is the start of the haystack, used only for reporting the match endpoints.
void f(char* ss, char* s, char* t, int mm, int ins, int del) {
while (*s && *s == *t) ++s, ++t; // OK to always match longest segment
if (!*t) printf("%d\n", s - ss); // Matched; print endpoint of match
if (mm && *s && *t) f(ss, s + 1, t + 1, mm - 1, ins, del);
if (ins && *s) f(ss, s + 1, t, mm, ins - 1, del);
if (del && *t) f(ss, s, t + 1, mm, ins, del - 1);
}
// Find all occurrences of t starting at any position in s, with at most
// mm mismatches, ins insertions and del deletions.
void ff(char* s, char* t, int mm, int ins, int del) {
for (char* ss = s; *s; ++s) {
// printf("Starting from offset %d...\n", s - ss);
f(ss, s, t, mm, ins, del);
}
}
Example call:
ff("xxabcydef", "abcdefg", 1, 1, 1);
This outputs:
9
9
because there are two ways to find "abcdefg" in "xxabcydef" with at most 1 of each kind of change, and both of these ways end at position 9:
Haystack: xxabcydef-
Needle: abc-defg
which has 1 insertion (of y) and 1 deletion (of g), and
Haystack: xxabcyde-f
Needle: abc-defg
which has 1 insertion (of y), 1 deletion (of f), and 1 substitution of g to f.
Dominance Relation
It may not be obvious why it's actually safe to use the while loop on line 3 to greedily match as many characters as possible at the start of the two strings. In fact this may reduce the number of times that a particular end position will be reported as a match, but it will never cause an end position to be forgotten completely -- and since we're usually interested in just whether or not there is a match ending at a given position of the haystack, and without this while loop the algorithm would always take time exponential in the needle size, this seems a win-win.
It is guaranteed to work because of a dominance relation. To see this, suppose the opposite -- that it is in fact unsafe (i.e. misses some matches). Then there would be some match in which an initial segment of equal characters from both strings are not aligned to each other, for example:
Haystack: abbbbc
Needle: a-b-bc
However, any such match can be transformed into another match having the same number of operations of each type, and ending at the same position, by shunting the leftmost character following a gap to the left of the gap:
Haystack: abbbbc
Needle: ab--bc
If you do this repeatedly until it's no longer possible to shunt characters without requiring a substitution, you will get a match in which the largest initial segment of equal characters from both strings are aligned to each other:
Haystack: abbbbc
Needle: abb--c
My algorithm will find all such matches, so it follows that no match position will be overlooked by it.
Exponential Time
Like any backtracking program, this function will exhibit exponential slowdowns on certain inputs. Of course, it may be that on the inputs you happen to use, this doesn't occur, and it works out faster than particular implementations of DP algorithms.
I would start with Levenshtein's distance algorithm, which is the standard approach when checking for string similarities via mismatch, insertion and deletion.
Since the algorithm uses bottom up dynamic programming, you'll probably be able to find all substrings without having to execute the algorithm for each potential substring.
The nicest algorithm I'm aware of for this is A Fast Bit-Vector Algorithm for Approximate String Matching Based on Dynamic Programming by Gene Myers. Given a text to search of length n, a pattern string to search for of length m and a maximum number of mismatches/insertions/deletions k, this algorithm takes time O(mn/w), where w is your computer's word size (32 or 64). If you know much about algorithms on strings, it's actually pretty incredible that an algorithm exists that takes time independent of k -- for a long time, this seemed an impossible goal.
I'm not aware of an existing implementation of the above algorithm. If you want a tool, agrep may be just what you need. It uses an earlier algorithm that takes time O(mnk/w), but it's fast enough for low k -- miles ahead of a backtracking search in the worst case.
agrep is based on the Shift-Or (or "Bitap") algorithm, which is a very clever dynamic programming algorithm that manages to represent its state as bits in an integer and get binary addition to do most of the work of updating the state, which is what speeds up the algorithm by a factor of 32 or 64 over a more typical implementation. :) Myers's algorithm also uses this idea to get its 1/w speed factor.
There is a file that contains 10G(1000000000) number of integers, please find the Median of these integers. you are given 2G memory to do this. Can anyone come up with an reasonable way? thanks!
Create an array of 8-byte longs that has 2^16 entries. Take your input numbers, shift off the bottom sixteen bits, and create a histogram.
Now you count up in that histogram until you reach the bin that covers the midpoint of the values.
Pass through again, ignoring all numbers that don't have that same set of top bits, and make a histogram of the bottom bits.
Count up through that histogram until you reach the bin that covers the midpoint of the (entire list of) values.
Now you know the median, in O(n) time and O(1) space (in practice, under 1 MB).
Here's some sample Scala code that does this:
def medianFinder(numbers: Iterable[Int]) = {
def midArgMid(a: Array[Long], mid: Long) = {
val cuml = a.scanLeft(0L)(_ + _).drop(1)
cuml.zipWithIndex.dropWhile(_._1 < mid).head
}
val topHistogram = new Array[Long](65536)
var count = 0L
numbers.foreach(number => {
count += 1
topHistogram(number>>>16) += 1
})
val (topCount,topIndex) = midArgMid(topHistogram, (count+1)/2)
val botHistogram = new Array[Long](65536)
numbers.foreach(number => {
if ((number>>>16) == topIndex) botHistogram(number & 0xFFFF) += 1
})
val (botCount,botIndex) =
midArgMid(botHistogram, (count+1)/2 - (topCount-topHistogram(topIndex)))
(topIndex<<16) + botIndex
}
and here it is working on a small set of input data:
scala> medianFinder(List(1,123,12345,1234567,123456789))
res18: Int = 12345
If you have 64 bit integers stored, you can use the same strategy in 4 passes instead.
You can use the Medians of Medians algorithm.
If the file is in text format, you may be able to fit it in memory just by converting things to integers as you read them in, since an integer stored as characters may take more space than an integer stored as an integer, depending on the size of the integers and the type of text file. EDIT: You edited your original question; I can see now that you can't read them into memory, see below.
If you can't read them into memory, this is what I came up with:
Figure out how many integers you have. You may know this from the start. If not, then it only takes one pass through the file. Let's say this is S.
Use your 2G of memory to find the x largest integers (however many you can fit). You can do one pass through the file, keeping the x largest in a sorted list of some sort, discarding the rest as you go. Now you know the x-th largest integer. You can discard all of these except for the x-th largest, which I'll call x1.
Do another pass through, finding the next x largest integers less than x1, the least of which is x2.
I think you can see where I'm going with this. After a few passes, you will have read in the (S/2)-th largest integer (you'll have to keep track of how many integers you've found), which is your median. If S is even then you'll average the two in the middle.
Make a pass through the file and find count of integers and minimum and maximum integer value.
Take midpoint of min and max, and get count, min and max for values either side of the midpoint - by again reading through the file.
partition count > count => median lies within that partition.
Repeat for the partition, taking into account size of 'partitions to the left' (easy to maintain), and also watching for min = max.
Am sure this'd work for an arbitrary number of partitions as well.
Do an on-disk external mergesort on the file to sort the integers (counting them if that's not already known).
Once the file is sorted, seek to the middle number (odd case), or average the two middle numbers (even case) in the file to get the median.
The amount of memory used is adjustable and unaffected by the number of integers in the original file. One caveat of the external sort is that the intermediate sorting data needs to be written to disk.
Given n = number of integers in the original file:
Running time: O(nlogn)
Memory: O(1), adjustable
Disk: O(n)
Check out Torben's method in here:http://ndevilla.free.fr/median/median/index.html. It also has implementation in C at the bottom of the document.
My best guess that probabilistic median of medians would be the fastest one. Recipe:
Take next set of N integers (N should be big enough, say 1000 or 10000 elements)
Then calculate median of these integers and assign it to variable X_new.
If iteration is not first - calculate median of two medians:
X_global = (X_global + X_new) / 2
When you will see that X_global fluctuates not much - this means that you found approximate median of data.
But there some notes :
question arises - Is median error acceptable or not.
integers must be distributed randomly in a uniform way, for solution to work
EDIT:
I've played a bit with this algorithm, changed a bit idea - in each iteration we should sum X_new with decreasing weight, such as:
X_global = k*X_global + (1.-k)*X_new :
k from [0.5 .. 1.], and increases in each iteration.
Point is to make calculation of median to converge fast to some number in very small amount of iterations. So that very approximate median (with big error) is found between 100000000 array elements in only 252 iterations !!! Check this C experiment:
#include <stdlib.h>
#include <stdio.h>
#include <time.h>
#define ARRAY_SIZE 100000000
#define RANGE_SIZE 1000
// probabilistic median of medians method
// should print 5000 as data average
// from ARRAY_SIZE of elements
int main (int argc, const char * argv[]) {
int iter = 0;
int X_global = 0;
int X_new = 0;
int i = 0;
float dk = 0.002;
float k = 0.5;
srand(time(NULL));
while (i<ARRAY_SIZE && k!=1.) {
X_new=0;
for (int j=i; j<i+RANGE_SIZE; j++) {
X_new+=rand()%10000 + 1;
}
X_new/=RANGE_SIZE;
if (iter>0) {
k += dk;
k = (k>1.)? 1.:k;
X_global = k*X_global+(1.-k)*X_new;
}
else {
X_global = X_new;
}
i+=RANGE_SIZE+1;
iter++;
printf("iter %d, median = %d \n",iter,X_global);
}
return 0;
}
Opps seems i'm talking about mean, not median. If it is so, and you need exactly median, not mean - ignore my post. In any case mean and median are very related concepts.
Good luck.
Here is the algorithm described by #Rex Kerr implemented in Java.
/**
* Computes the median.
* #param arr Array of strings, each element represents a distinct binary number and has the same number of bits (padded with leading zeroes if necessary)
* #return the median (number of rank ceil((m+1)/2) ) of the array as a string
*/
static String computeMedian(String[] arr) {
// rank of the median element
int m = (int) Math.ceil((arr.length+1)/2.0);
String bitMask = "";
int zeroBin = 0;
while (bitMask.length() < arr[0].length()) {
// puts elements which conform to the bitMask into one of two buckets
for (String curr : arr) {
if (curr.startsWith(bitMask))
if (curr.charAt(bitMask.length()) == '0')
zeroBin++;
}
// decides in which bucket the median is located
if (zeroBin >= m)
bitMask = bitMask.concat("0");
else {
m -= zeroBin;
bitMask = bitMask.concat("1");
}
zeroBin = 0;
}
return bitMask;
}
Some test cases and updates to the algorithm can be found here.
I was also asked the same question and i couldn't tell an exact answer so after the interview i went through some books on interviews and here is what i found from Cracking The Coding interview book.
Example: Numbers are randomly generated and stored into an (expanding) array. How
wouldyoukeep track of the median?
Our data structure brainstorm might look like the following:
• Linked list? Probably not. Linked lists tend not to do very well with accessing and
sorting numbers.
• Array? Maybe, but you already have an array. Could you somehow keep the elements
sorted? That's probably expensive. Let's hold off on this and return to it if it's needed.
• Binary tree? This is possible, since binary trees do fairly well with ordering. In fact, if the binary search tree is perfectly balanced, the top might be the median. But, be careful—if there's an even number of elements, the median is actually the average
of the middle two elements. The middle two elements can't both be at the top. This is probably a workable algorithm, but let's come back to it.
• Heap? A heap is really good at basic ordering and keeping track of max and mins.
This is actually interesting—if you had two heaps, you could keep track of the bigger
half and the smaller half of the elements. The bigger half is kept in a min heap, such
that the smallest element in the bigger half is at the root.The smaller half is kept in a
max heap, such that the biggest element of the smaller half is at the root. Now, with
these data structures, you have the potential median elements at the roots. If the
heaps are no longer the same size, you can quickly "rebalance" the heaps by popping
an element off the one heap and pushing it onto the other.
Note that the more problems you do, the more developed your instinct on which data
structure to apply will be. You will also develop a more finely tuned instinct as to which of these approaches is the most useful.
I have a string s and I want to search for the substring of length X that occurs most often in s. Overlapping substrings are allowed.
For example, if s="aoaoa" and X=3, the algorithm should find "aoa" (which appears 2 times in s).
Does an algorithm exist that does this in O(n) time?
You can do this using a rolling hash in O(n) time (assuming good hash distribution). A simple rolling hash would be the xor of the characters in the string, you can compute it incrementally from the previous substring hash using just 2 xors. (See the Wikipedia entry for better rolling hashes than xor.) Compute the hash of your n-x+1 substrings using the rolling hash in O(n) time. If there were no collisions, the answer is clear - if collisions happen, you'll need to do more work. My brain hurts trying to figure out if that can all be resolved in O(n) time.
Update:
Here's a randomized O(n) algorithm. You can find the top hash in O(n) time by scanning the hashtable (keeping it simple, assume no ties). Find one X-length string with that hash (keep a record in the hashtable, or just redo the rolling hash). Then use an O(n) string searching algorithm to find all occurrences of that string in s. If you find the same number of occurrences as you recorded in the hashtable, you're done.
If not, that means you have a hash collision. Pick a new random hash function and try again. If your hash function has log(n)+1 bits and is pairwise independent [Prob(h(s) == h(t)) < 1/2^{n+1} if s != t], then the probability that the most frequent x-length substring in s hash a collision with the <=n other length x substrings of s is at most 1/2. So if there is a collision, pick a new random hash function and retry, you will need only a constant number of tries before you succeed.
Now we only need a randomized pairwise independent rolling hash algorithm.
Update2:
Actually, you need 2log(n) bits of hash to avoid all (n choose 2) collisions because any collision may hide the right answer. Still doable, and it looks like hashing by general polynomial division should do the trick.
I don't see an easy way to do this in strictly O(n) time, unless X is fixed and can be considered a constant. If X is a parameter to the algorithm, then most simple ways of doing this will actually be O(n*X), as you will need to do comparison operations, string copies, hashes, etc., on a substring of length X at every iteration.
(I'm imagining, for a minute, that s is a multi-gigabyte string, and that X is some number over a million, and not seeing any simple ways of doing string comparison, or hashing substrings of length X, that are O(1), and not dependent on the size of X)
It might be possible to avoid string copies during scanning, by leaving everything in place, and to avoid re-hashing the entire substring -- perhaps by using an incremental hash algorithm where you can add a byte at a time, and remove the oldest byte -- but I don't know of any such algorithms that wouldn't result in huge numbers of collisions that would need to be filtered out with an expensive post-processing step.
Update
Keith Randall points out that this kind of hash is known as a rolling hash. It still remains, though, that you would have to store the starting string position for each match in your hash table, and then verify after scanning the string that all of your matches were true. You would need to sort the hashtable, which could contain n-X entries, based on the number of matches found for each hash key, and verify each result -- probably not doable in O(n).
It should be O(n*m) where m is the average length of a string in the list. For very small values of m then the algorithm will approach O(n)
Build a hashtable of counts for each string length
Iterate over your collection of strings, updating the hashtable accordingly, storing the current most prevelant number as an integer variable separate from the hashtable
done.
Naive solution in Python
from collections import defaultdict
from operator import itemgetter
def naive(s, X):
freq = defaultdict(int)
for i in range(len(s) - X + 1):
freq[s[i:i+X]] += 1
return max(freq.iteritems(), key=itemgetter(1))
print naive("aoaoa", 3)
# -> ('aoa', 2)
In plain English
Create mapping: substring of length X -> how many times it occurs in the s string
for i in range(len(s) - X + 1):
freq[s[i:i+X]] += 1
Find a pair in the mapping with the largest second item (frequency)
max(freq.iteritems(), key=itemgetter(1))
Here is a version I did in C. Hope that it helps.
#include <stdio.h>
#include <stdlib.h>
#include <string.h>
int main(void)
{
char *string = NULL, *maxstring = NULL, *tmpstr = NULL, *tmpstr2 = NULL;
unsigned int n = 0, i = 0, j = 0, matchcount = 0, maxcount = 0;
string = "aoaoa";
n = 3;
for (i = 0; i <= (strlen(string) - n); i++) {
tmpstr = (char *)malloc(n + 1);
strncpy(tmpstr, string + i, n);
*(tmpstr + (n + 1)) = '\0';
for (j = 0; j <= (strlen(string) - n); j++) {
tmpstr2 = (char *)malloc(n + 1);
strncpy(tmpstr2, string + j, n);
*(tmpstr2 + (n + 1)) = '\0';
if (!strcmp(tmpstr, tmpstr2))
matchcount++;
}
if (matchcount > maxcount) {
maxstring = tmpstr;
maxcount = matchcount;
}
matchcount = 0;
}
printf("max string: \"%s\", count: %d\n", maxstring, maxcount);
free(tmpstr);
free(tmpstr2);
return 0;
}
You can build a tree of sub-strings. The idea is to organise your sub-strings like a telephone book. You then look up the sub-string and increase its count by one.
In your example above, the tree will have sections (nodes) starting with the letters: 'a' and 'o'. 'a' appears three times and 'o' appears twice. So those nodes will have a count of 3 and 2 respectively.
Next, under the 'a' node a sub-node of 'o' will appear corresponding to the sub-string 'ao'. This appears twice. Under the 'o' node 'a' also appears twice.
We carry on in this fashion until we reach the end of the string.
A representation of the tree for 'abac' might be (nodes on the same level are separated by a comma, sub-nodes are in brackets, counts appear after the colon).
a:2(b:1(a:1(c:1())),c:1()),b:1(a:1(c:1())),c:1()
If the tree is drawn out it will be a lot more obvious! What this all says for example is that the string 'aba' appears once, or the string 'a' appears twice etc. But, storage is greatly reduced and more importantly retrieval is greatly speeded up (compare this to keeping a list of sub-strings).
To find out which sub-string is most repeated, do a depth first search of the tree, every time a leaf node is reached, note the count, and keep a track of the highest one.
The running time is probably something like O(log(n)) not sure, but certainly better than O(n^2).
Python-3 Solution:
from collections import Counter
list = []
list.append([string[i: j] for i in range(len(string)) for j in range(i + 1, len(string) + 1) if len(string[i:j]) == K]) # Where K is length
# now find the most common value in this list
# you can do this natively, but I prefer using collections
most_frequent = Counter(list).most_common(1)[0][0]
print(most_freqent)
Here is the native way to get the most common (for those that are interested):
most_occurences = 0
current_most = ""
for i in list:
frequency = list.count(i)
if frequency > most_occurences:
most_occurences = frequency
current_most = list[i]
print(f"{current_most}, Occurences: {most_occurences}")
[Extract K length substrings (geeks for geeks)][1]
[1]: https://www.geeksforgeeks.org/python-extract-k-length-substrings/
LZW algorithm does this
This is exactly what Lempel-Ziv-Welch (LZW used in GIF image format) compression algorithm does. It finds prevalent repeated bytes and changes them for something short.
LZW on Wikipedia
There's no way to do this in O(n).
Feel free to downvote me if you can prove me wrong on this one, but I've got nothing.
Given a long string L and a shorter string S (the constraint is that L.length must be >= S.length), I want to find the minimum Hamming distance between S and any substring of L with length equal to S.length. Let's call the function for this minHamming(). For example,
minHamming(ABCDEFGHIJ, CDEFGG) == 1.
minHamming(ABCDEFGHIJ, BCDGHI) == 3.
Doing this the obvious way (enumerating every substring of L) requires O(S.length * L.length) time. Is there any clever way to do this in sublinear time? I search the same L with several different S strings, so doing some complicated preprocessing to L once is acceptable.
Edit: The modified Boyer-Moore would be a good idea, except that my alphabet is only 4 letters (DNA).
Perhaps surprisingly, this exact problem can be solved in just O(|A|nlog n) time using Fast Fourier Transforms (FFTs), where n is the length of the larger sequence L and |A| is the size of the alphabet.
Here is a freely available PDF of a paper by Donald Benson describing how it works:
Fourier methods for biosequence analysis (Donald Benson, Nucleic Acids Research 1990 vol. 18, pp. 3001-3006)
Summary: Convert each of your strings S and L into several indicator vectors (one per character, so 4 in the case of DNA), and then convolve corresponding vectors to determine match counts for each possible alignment. The trick is that convolution in the "time" domain, which ordinarily requires O(n^2) time, can be implemented using multiplication in the "frequency" domain, which requires just O(n) time, plus the time required to convert between domains and back again. Using the FFT each conversion takes just O(nlog n) time, so the overall time complexity is O(|A|nlog n). For greatest speed, finite field FFTs are used, which require only integer arithmetic.
Note: For arbitrary S and L this algorithm is clearly a huge performance win over the straightforward O(mn) algorithm as |S| and |L| become large, but OTOH if S is typically shorter than log|L| (e.g. when querying a large DB with a small sequence), then obviously this approach provides no speedup.
UPDATE 21/7/2009: Updated to mention that the time complexity also depends linearly on the size of the alphabet, since a separate pair of indicator vectors must be used for each character in the alphabet.
Modified Boyer-Moore
I've just dug up some old Python implementation of Boyer-Moore I had lying around and modified the matching loop (where the text is compared to the pattern). Instead of breaking out as soon as the first mismatch is found between the two strings, simply count up the number of mismatches, but remember the first mismatch:
current_dist = 0
while pattern_pos >= 0:
if pattern[pattern_pos] != text[text_pos]:
if first_mismatch == -1:
first_mismatch = pattern_pos
tp = text_pos
current_dist += 1
if current_dist == smallest_dist:
break
pattern_pos -= 1
text_pos -= 1
smallest_dist = min(current_dist, smallest_dist)
# if the distance is 0, we've had a match and can quit
if current_dist == 0:
return 0
else: # shift
pattern_pos = first_mismatch
text_pos = tp
...
If the string did not match completely at this point, go back to the point of the first mismatch by restoring the values. This makes sure that the smallest distance is actually found.
The whole implementation is rather long (~150LOC), but I can post it on request. The core idea is outlined above, everything else is standard Boyer-Moore.
Preprocessing on the Text
Another way to speed things up is preprocessing the text to have an index on character positions. You only want to start comparing at positions where at least a single match between the two strings occurs, otherwise the Hamming distance is |S| trivially.
import sys
from collections import defaultdict
import bisect
def char_positions(t):
pos = defaultdict(list)
for idx, c in enumerate(t):
pos[c].append(idx)
return dict(pos)
This method simply creates a dictionary which maps each character in the text to the sorted list of its occurrences.
The comparison loop is more or less unchanged to naive O(mn) approach, apart from the fact that we do not increase the position at which comparison is started by 1 each time, but based on the character positions:
def min_hamming(text, pattern):
best = len(pattern)
pos = char_positions(text)
i = find_next_pos(pattern, pos, 0)
while i < len(text) - len(pattern):
dist = 0
for c in range(len(pattern)):
if text[i+c] != pattern[c]:
dist += 1
if dist == best:
break
c += 1
else:
if dist == 0:
return 0
best = min(dist, best)
i = find_next_pos(pattern, pos, i + 1)
return best
The actual improvement is in find_next_pos:
def find_next_pos(pattern, pos, i):
smallest = sys.maxint
for idx, c in enumerate(pattern):
if c in pos:
x = bisect.bisect_left(pos[c], i + idx)
if x < len(pos[c]):
smallest = min(smallest, pos[c][x] - idx)
return smallest
For each new position, we find the lowest index at which a character from S occurs in L. If there is no such index any more, the algorithm will terminate.
find_next_pos is certainly complex, and one could try to improve it by only using the first several characters of the pattern S, or use a set to make sure characters from the pattern are not checked twice.
Discussion
Which method is faster largely depends on your dataset. The more diverse your alphabet is, the larger will be the jumps. If you have a very long L, the second method with preprocessing might be faster. For very, very short strings (like in your question), the naive approach will certainly be the fastest.
DNA
If you have a very small alphabet, you could try to get the character positions for character bigrams (or larger) rather than unigrams.
You're stuck as far as big-O is concerned.. At a fundamental level, you're going to need to test if every letter in the target matches each eligible letter in the substring.
Luckily, this is easily parallelized.
One optimization you can apply is to keep a running count of mismatches for the current position. If it's greater than the lowest hamming distance so far, then obviously you can skip to the next possibility.
This is a long text. Please bear with me. Boiled down, the question is: Is there a workable in-place radix sort algorithm?
Preliminary
I've got a huge number of small fixed-length strings that only use the letters “A”, “C”, “G” and “T” (yes, you've guessed it: DNA) that I want to sort.
At the moment, I use std::sort which uses introsort in all common implementations of the STL. This works quite well. However, I'm convinced that radix sort fits my problem set perfectly and should work much better in practice.
Details
I've tested this assumption with a very naive implementation and for relatively small inputs (on the order of 10,000) this was true (well, at least more than twice as fast). However, runtime degrades abysmally when the problem size becomes larger (N > 5,000,000).
The reason is obvious: radix sort requires copying the whole data (more than once in my naive implementation, actually). This means that I've put ~ 4 GiB into my main memory which obviously kills performance. Even if it didn't, I can't afford to use this much memory since the problem sizes actually become even larger.
Use Cases
Ideally, this algorithm should work with any string length between 2 and 100, for DNA as well as DNA5 (which allows an additional wildcard character “N”), or even DNA with IUPAC ambiguity codes (resulting in 16 distinct values). However, I realize that all these cases cannot be covered, so I'm happy with any speed improvement I get. The code can decide dynamically which algorithm to dispatch to.
Research
Unfortunately, the Wikipedia article on radix sort is useless. The section about an in-place variant is complete rubbish. The NIST-DADS section on radix sort is next to nonexistent. There's a promising-sounding paper called Efficient Adaptive In-Place Radix Sorting which describes the algorithm “MSL”. Unfortunately, this paper, too, is disappointing.
In particular, there are the following things.
First, the algorithm contains several mistakes and leaves a lot unexplained. In particular, it doesn’t detail the recursion call (I simply assume that it increments or reduces some pointer to calculate the current shift and mask values). Also, it uses the functions dest_group and dest_address without giving definitions. I fail to see how to implement these efficiently (that is, in O(1); at least dest_address isn’t trivial).
Last but not least, the algorithm achieves in-place-ness by swapping array indices with elements inside the input array. This obviously only works on numerical arrays. I need to use it on strings. Of course, I could just screw strong typing and go ahead assuming that the memory will tolerate my storing an index where it doesn’t belong. But this only works as long as I can squeeze my strings into 32 bits of memory (assuming 32 bit integers). That's only 16 characters (let's ignore for the moment that 16 > log(5,000,000)).
Another paper by one of the authors gives no accurate description at all, but it gives MSL’s runtime as sub-linear which is flat out wrong.
To recap: Is there any hope of finding a working reference implementation or at least a good pseudocode/description of a working in-place radix sort that works on DNA strings?
Well, here's a simple implementation of an MSD radix sort for DNA. It's written in D because that's the language that I use most and therefore am least likely to make silly mistakes in, but it could easily be translated to some other language. It's in-place but requires 2 * seq.length passes through the array.
void radixSort(string[] seqs, size_t base = 0) {
if(seqs.length == 0)
return;
size_t TPos = seqs.length, APos = 0;
size_t i = 0;
while(i < TPos) {
if(seqs[i][base] == 'A') {
swap(seqs[i], seqs[APos++]);
i++;
}
else if(seqs[i][base] == 'T') {
swap(seqs[i], seqs[--TPos]);
} else i++;
}
i = APos;
size_t CPos = APos;
while(i < TPos) {
if(seqs[i][base] == 'C') {
swap(seqs[i], seqs[CPos++]);
}
i++;
}
if(base < seqs[0].length - 1) {
radixSort(seqs[0..APos], base + 1);
radixSort(seqs[APos..CPos], base + 1);
radixSort(seqs[CPos..TPos], base + 1);
radixSort(seqs[TPos..seqs.length], base + 1);
}
}
Obviously, this is kind of specific to DNA, as opposed to being general, but it should be fast.
Edit:
I got curious whether this code actually works, so I tested/debugged it while waiting for my own bioinformatics code to run. The version above now is actually tested and works. For 10 million sequences of 5 bases each, it's about 3x faster than an optimized introsort.
I've never seen an in-place radix sort, and from the nature of the radix-sort I doubt that it is much faster than a out of place sort as long as the temporary array fits into memory.
Reason:
The sorting does a linear read on the input array, but all writes will be nearly random. From a certain N upwards this boils down to a cache miss per write. This cache miss is what slows down your algorithm. If it's in place or not will not change this effect.
I know that this will not answer your question directly, but if sorting is a bottleneck you may want to have a look at near sorting algorithms as a preprocessing step (the wiki-page on the soft-heap may get you started).
That could give a very nice cache locality boost. A text-book out-of-place radix sort will then perform better. The writes will still be nearly random but at least they will cluster around the same chunks of memory and as such increase the cache hit ratio.
I have no idea if it works out in practice though.
Btw: If you're dealing with DNA strings only: You can compress a char into two bits and pack your data quite a lot. This will cut down the memory requirement by factor four over a naiive representation. Addressing becomes more complex, but the ALU of your CPU has lots of time to spend during all the cache-misses anyway.
You can certainly drop the memory requirements by encoding the sequence in bits.
You are looking at permutations so, for length 2, with "ACGT" that's 16 states, or 4 bits.
For length 3, that's 64 states, which can be encoded in 6 bits. So it looks like 2 bits for each letter in the sequence, or about 32 bits for 16 characters like you said.
If there is a way to reduce the number of valid 'words', further compression may be possible.
So for sequences of length 3, one could create 64 buckets, maybe sized uint32, or uint64.
Initialize them to zero.
Iterate through your very very large list of 3 char sequences, and encode them as above.
Use this as a subscript, and increment that bucket.
Repeat this until all of your sequences have been processed.
Next, regenerate your list.
Iterate through the 64 buckets in order, for the count found in that bucket, generate that many instances of the sequence represented by that bucket.
when all of the buckets have been iterated, you have your sorted array.
A sequence of 4, adds 2 bits, so there would be 256 buckets.
A sequence of 5, adds 2 bits, so there would be 1024 buckets.
At some point the number of buckets will approach your limits.
If you read the sequences from a file, instead of keeping them in memory, more memory would be available for buckets.
I think this would be faster than doing the sort in situ as the buckets are likely to fit within your working set.
Here is a hack that shows the technique
#include <iostream>
#include <iomanip>
#include <math.h>
using namespace std;
const int width = 3;
const int bucketCount = exp(width * log(4)) + 1;
int *bucket = NULL;
const char charMap[4] = {'A', 'C', 'G', 'T'};
void setup
(
void
)
{
bucket = new int[bucketCount];
memset(bucket, '\0', bucketCount * sizeof(bucket[0]));
}
void teardown
(
void
)
{
delete[] bucket;
}
void show
(
int encoded
)
{
int z;
int y;
int j;
for (z = width - 1; z >= 0; z--)
{
int n = 1;
for (y = 0; y < z; y++)
n *= 4;
j = encoded % n;
encoded -= j;
encoded /= n;
cout << charMap[encoded];
encoded = j;
}
cout << endl;
}
int main(void)
{
// Sort this sequence
const char *testSequence = "CAGCCCAAAGGGTTTAGACTTGGTGCGCAGCAGTTAAGATTGTTT";
size_t testSequenceLength = strlen(testSequence);
setup();
// load the sequences into the buckets
size_t z;
for (z = 0; z < testSequenceLength; z += width)
{
int encoding = 0;
size_t y;
for (y = 0; y < width; y++)
{
encoding *= 4;
switch (*(testSequence + z + y))
{
case 'A' : encoding += 0; break;
case 'C' : encoding += 1; break;
case 'G' : encoding += 2; break;
case 'T' : encoding += 3; break;
default : abort();
};
}
bucket[encoding]++;
}
/* show the sorted sequences */
for (z = 0; z < bucketCount; z++)
{
while (bucket[z] > 0)
{
show(z);
bucket[z]--;
}
}
teardown();
return 0;
}
If your data set is so big, then I would think that a disk-based buffer approach would be best:
sort(List<string> elements, int prefix)
if (elements.Count < THRESHOLD)
return InMemoryRadixSort(elements, prefix)
else
return DiskBackedRadixSort(elements, prefix)
DiskBackedRadixSort(elements, prefix)
DiskBackedBuffer<string>[] buckets
foreach (element in elements)
buckets[element.MSB(prefix)].Add(element);
List<string> ret
foreach (bucket in buckets)
ret.Add(sort(bucket, prefix + 1))
return ret
I would also experiment grouping into a larger number of buckets, for instance, if your string was:
GATTACA
the first MSB call would return the bucket for GATT (256 total buckets), that way you make fewer branches of the disk based buffer. This may or may not improve performance, so experiment with it.
I'm going to go out on a limb and suggest you switch to a heap/heapsort implementation. This suggestion comes with some assumptions:
You control the reading of the data
You can do something meaningful with the sorted data as soon as you 'start' getting it sorted.
The beauty of the heap/heap-sort is that you can build the heap while you read the data, and you can start getting results the moment you have built the heap.
Let's step back. If you are so fortunate that you can read the data asynchronously (that is, you can post some kind of read request and be notified when some data is ready), and then you can build a chunk of the heap while you are waiting for the next chunk of data to come in - even from disk. Often, this approach can bury most of the cost of half of your sorting behind the time spent getting the data.
Once you have the data read, the first element is already available. Depending on where you are sending the data, this can be great. If you are sending it to another asynchronous reader, or some parallel 'event' model, or UI, you can send chunks and chunks as you go.
That said - if you have no control over how the data is read, and it is read synchronously, and you have no use for the sorted data until it is entirely written out - ignore all this. :(
See the Wikipedia articles:
Heapsort
Binary heap
"Radix sorting with no extra space" is a paper addressing your problem.
Performance-wise you might want to look at a more general string-comparison sorting algorithms.
Currently you wind up touching every element of every string, but you can do better!
In particular, a burst sort is a very good fit for this case. As a bonus, since burstsort is based on tries, it works ridiculously well for the small alphabet sizes used in DNA/RNA, since you don't need to build any sort of ternary search node, hash or other trie node compression scheme into the trie implementation. The tries may be useful for your suffix-array-like final goal as well.
A decent general purpose implementation of burstsort is available on source forge at http://sourceforge.net/projects/burstsort/ - but it is not in-place.
For comparison purposes, The C-burstsort implementation covered at http://www.cs.mu.oz.au/~rsinha/papers/SinhaRingZobel-2006.pdf benchmarks 4-5x faster than quicksort and radix sorts for some typical workloads.
You'll want to take a look at Large-scale Genome Sequence Processing by Drs. Kasahara and Morishita.
Strings comprised of the four nucleotide letters A, C, G, and T can be specially encoded into Integers for much faster processing. Radix sort is among many algorithms discussed in the book; you should be able to adapt the accepted answer to this question and see a big performance improvement.
You might try using a trie. Sorting the data is simply iterating through the dataset and inserting it; the structure is naturally sorted, and you can think of it as similar to a B-Tree (except instead of making comparisons, you always use pointer indirections).
Caching behavior will favor all of the internal nodes, so you probably won't improve upon that; but you can fiddle with the branching factor of your trie as well (ensure that every node fits into a single cache line, allocate trie nodes similar to a heap, as a contiguous array that represents a level-order traversal). Since tries are also digital structures (O(k) insert/find/delete for elements of length k), you should have competitive performance to a radix sort.
I would burstsort a packed-bit representation of the strings. Burstsort is claimed to have much better locality than radix sorts, keeping the extra space usage down with burst tries in place of classical tries. The original paper has measurements.
It looks like you've solved the problem, but for the record, it appears that one version of a workable in-place radix sort is the "American Flag Sort". It's described here: Engineering Radix Sort. The general idea is to do 2 passes on each character - first count how many of each you have, so you can subdivide the input array into bins. Then go through again, swapping each element into the correct bin. Now recursively sort each bin on the next character position.
Radix-Sort is not cache conscious and is not the fastest sort algorithm for large sets.
You can look at:
ti7qsort. ti7qsort is the fastest sort for integers (can be used for small-fixed size strings).
Inline QSORT
String sorting
You can also use compression and encode each letter of your DNA into 2 bits before storing into the sort array.
dsimcha's MSB radix sort looks nice, but Nils gets closer to the heart of the problem with the observation that cache locality is what's killing you at large problem sizes.
I suggest a very simple approach:
Empirically estimate the largest size m for which a radix sort is efficient.
Read blocks of m elements at a time, radix sort them, and write them out (to a memory buffer if you have enough memory, but otherwise to file), until you exhaust your input.
Mergesort the resulting sorted blocks.
Mergesort is the most cache-friendly sorting algorithm I'm aware of: "Read the next item from either array A or B, then write an item to the output buffer." It runs efficiently on tape drives. It does require 2n space to sort n items, but my bet is that the much-improved cache locality you'll see will make that unimportant -- and if you were using a non-in-place radix sort, you needed that extra space anyway.
Please note finally that mergesort can be implemented without recursion, and in fact doing it this way makes clear the true linear memory access pattern.
First, think about the coding of your problem. Get rid of the strings, replace them by a binary representation. Use the first byte to indicate length+encoding. Alternatively, use a fixed length representation at a four-byte boundary. Then the radix sort becomes much easier. For a radix sort, the most important thing is to not have exception handling at the hot spot of the inner loop.
OK, I thought a bit more about the 4-nary problem. You want a solution like a Judy tree for this. The next solution can handle variable length strings; for fixed length just remove the length bits, that actually makes it easier.
Allocate blocks of 16 pointers. The least significant bit of the pointers can be reused, as your blocks will always be aligned. You might want a special storage allocator for it (breaking up large storage into smaller blocks). There are a number of different kinds of blocks:
Encoding with 7 length bits of variable-length strings. As they fill up, you replace them by:
Position encodes the next two characters, you have 16 pointers to the next blocks, ending with:
Bitmap encoding of the last three characters of a string.
For each kind of block, you need to store different information in the LSBs. As you have variable length strings you need to store end-of-string too, and the last kind of block can only be used for the longest strings. The 7 length bits should be replaced by less as you get deeper into the structure.
This provides you with a reasonably fast and very memory efficient storage of sorted strings. It will behave somewhat like a trie. To get this working, make sure to build enough unit tests. You want coverage of all block transitions. You want to start with only the second kind of block.
For even more performance, you might want to add different block types and a larger size of block. If the blocks are always the same size and large enough, you can use even fewer bits for the pointers. With a block size of 16 pointers, you already have a byte free in a 32-bit address space. Take a look at the Judy tree documentation for interesting block types. Basically, you add code and engineering time for a space (and runtime) trade-off
You probably want to start with a 256 wide direct radix for the first four characters. That provides a decent space/time tradeoff. In this implementation, you get much less memory overhead than with a simple trie; it is approximately three times smaller (I haven't measured). O(n) is no problem if the constant is low enough, as you noticed when comparing with the O(n log n) quicksort.
Are you interested in handling doubles? With short sequences, there are going to be. Adapting the blocks to handle counts is tricky, but it can be very space-efficient.
While the accepted answer perfectly answers the description of the problem, I've reached this place looking in vain for an algorithm to partition inline an array into N parts. I've written one myself, so here it is.
Warning: this is not a stable partitioning algorithm, so for multilevel partitioning, one must repartition each resulting partition instead of the whole array. The advantage is that it is inline.
The way it helps with the question posed is that you can repeatedly partition inline based on a letter of the string, then sort the partitions when they are small enough with the algorithm of your choice.
function partitionInPlace(input, partitionFunction, numPartitions, startIndex=0, endIndex=-1) {
if (endIndex===-1) endIndex=input.length;
const starts = Array.from({ length: numPartitions + 1 }, () => 0);
for (let i = startIndex; i < endIndex; i++) {
const val = input[i];
const partByte = partitionFunction(val);
starts[partByte]++;
}
let prev = startIndex;
for (let i = 0; i < numPartitions; i++) {
const p = prev;
prev += starts[i];
starts[i] = p;
}
const indexes = [...starts];
starts[numPartitions] = prev;
let bucket = 0;
while (bucket < numPartitions) {
const start = starts[bucket];
const end = starts[bucket + 1];
if (end - start < 1) {
bucket++;
continue;
}
let index = indexes[bucket];
if (index === end) {
bucket++;
continue;
}
let val = input[index];
let destBucket = partitionFunction(val);
if (destBucket === bucket) {
indexes[bucket] = index + 1;
continue;
}
let dest;
do {
dest = indexes[destBucket] - 1;
let destVal;
let destValBucket = destBucket;
while (destValBucket === destBucket) {
dest++;
destVal = input[dest];
destValBucket = partitionFunction(destVal);
}
input[dest] = val;
indexes[destBucket] = dest + 1;
val = destVal;
destBucket = destValBucket;
} while (dest !== index)
}
return starts;
}