I am extracting the values in fourth column of a file and trying to add them.
#!/bin/bash
cat tag_FLI1 | awk '{print $4}'>tags
$t=0
for i in `cat tags`
do
$t=$t+$i (this is the position of trouble)
done
echo $t
error on line 6.
Thank you in advance for your time.
In case of using only awk for the task:
If fields are separated with blanks:
awk '{ sum += $4 } END { print sum }' tag_FLI1
Otherwise, use FS variable, like:
awk 'BEGIN { FS = "|" } { sum += $4 } END { print sum }' tag_FLI1
That's not how you do arithmetic in bash. To add the values from two variables x and y and store the result in a third variable z, it should look like this:
z=$((x + y))
However, you could more simply just do everything in awk, replacing your awk '{print $4}' with:
awk '{ sum += $4 } END { print sum }'
The awk approach will also correctly handle floating point numbers, which the bash approach will not.
You need to use a numeric context for adding the numbers. Also, cat is not needed here, as awk can read from a file. Unless you use "tags" in another script, you don't need to create the file. Also, if you are using bash and not perl or php, there shouldn't be a "$" on the left side of a variable assignment.
t=0
while read -r i
do
t=$((t + i))
done < <(awk '{print $4}' tag_FLI1)
echo "$t"
That can be done in just one line:
awk '{sum += $4} END {print sum}' tag_FLI1
However, if this is a learning exercise for bash, have a look at this example:
#!/bin/bash
sum=0
while read line; do
(( sum += $line ))
done < <(awk '{print $4}' tag_FLI1)
echo $sum
There were essentially 3 issues with your code:
Variables are assigned using VAR=..., not $VAR=.... See http://tldp.org/LDP/abs/html/varassignment.html
The way you sum the numers is incorrect. See arithmetic expansion for examples of how to do it.
It is not necessary to use an intermediate file just to iterate through the output of a command. Use a while loop as show above, but beware of this caveat.
Related
I'm trying to write a simple script to make several replacements in a big text file. I've a "map" file which contains the records to be searched and replaced,one per line,separated by a space, and a "input" file where I need the changes to be done. The examples files and the script I wrote are beneath.
Map file
new_0 old_0
new_1 old_1
new_2 old_2
new_3 old_3
new_4 old_4
Input file
itsa(old_0)single(old_2)string(old_1)with(old_5)ocurrences(old_4)ofthe(old_3)records
Script
#!/bin/bash
while read -r mapline ; do
mapf1=`awk 'BEGIN {FS=" "} {print $1}' <<< "$mapline"`
mapf2=`awk 'BEGIN {FS=" "} {print $2}' <<< "$mapline"`
for line in $(cat "input") ; do
if [[ "${line}" == *"${mapf2}"* ]] ; then
sed "s/${mapf2}/${mapf1}/g" <<< "${line}"
fi
done < "input"
done < "map"
The thing is that the searches and replaces are made correctly, but I can't find a way to save the output of each iteration and work over it in the next. So, my output looks like this:
itsa(new_0)single(old_2)string(old_1)withocurrences(old_4)ofthe(old_3)records
itsa(old_0)single(old_2)string(new_1)withocurrences(old_4)ofthe(old_3)records
itsa(old_0)single(new_2)string(old_1)withocurrences(old_4)ofthe(old_3)records
itsa(old_0)single(old_2)string(old_1)withocurrences(old_4)ofthe(new_3)records
itsa(old_0)single(old_2)string(old_1)withocurrences(new_4)ofthe(old_3)records
Yet, the desired output would look like this:
itsa(new_0)single(new_2)string(new_1)withocurrences(new_4)ofthe(new_3)records
May anyone bring some light in this darkly waters??? Thanks in advance!
Improving the existing script
Improvements:
Use "$()" instead of ``. It supports whitespace and is easier to read.
Don't execute sed for each line. sed already loops over all lines and is faster than a loop in bash.
The adapted script:
text="$(< input)"
while read -r mapline; do
mapf1="$(awk 'BEGIN {FS=" "} {print $1}' <<< "$mapline")"
mapf2="$(awk 'BEGIN {FS=" "} {print $2}' <<< "$mapline")"
text="$(sed "s/${mapf2}/${mapf1}/g" <<< "$text")"
done < "map"
echo "$text"
The variable $text contains the complete input file and is modified in each iteration. The output of this script is the file after all replacements were done.
Alternative approach
Convert the map file into a pattern for sed and execute sed just once using that pattern.
pattern="$(sed 's#\(.*\) \(.*\)#s/\2/\1/g#' map)"
sed "$pattern" input
The first command is the conversion step. The file
new_0 old_0
new_1 old_1
...
will result in the pattern
s/old_0/new_0/g
s/old_1/new_1/g
...
It is possible in GNU Awk as follows,
awk 'FNR==NR{hash[$2]=$1; next} \
{for (i=1; i<=NF; i++)\
{for(key in hash) \
{if (match ($i,key)) {$i=sprintf("(%s)",hash[key];break;)}}}print}' \
map-file FS='[()]' OFS= input-file
produces an output as,
itsa(new_0)single(new_2)string(new_1)withold_5ocurrences(new_4)ofthe(new_3)records
Another in Gnu awk, using split and ternary operator(s):
$ awk '
NR==FNR { a[$2]=$1; next }
{
n=split($0,b,"[()]")
for(i=1;i<=n;i++)
printf "%s%s",(i%2 ? b[i] : (b[i] in a? "(" a[b[i]] ")":"")),(i==n?ORS:"")
}' map foo
itsa(new_0)single(new_2)string(new_1)withocurrences(new_4)ofthe(new_3)records
First you read in the map to a hash. When processing the file, split all records by ( and ). Every other could be in the map (i%2==0). While printfing test with ternary operator if matches are found from a and when there is a match, output it parenthesized.
I have two columns in a file, and I want to automate summing both values per row
for example
read write
5 6
read write
10 2
read write
23 44
I want to then sum the "read" and "write" of each row. Eventually after summing, I'm finding the max sum and putting that max value in a file. I feel like I have to use grep -v to rid of the column headers per row, which like stated in the answers, makes the code inefficient since I'm grepping the entire file just to read a line.
I currently have this in a bash script (within a for loop where $x is the file name) to sum the columns line by line
lines=`grep -v READ $x|wc -l | awk '{print $1}'`
line_num=1
arr_num=0
while [ $line_num -le $lines ]
do
arr[$arr_num]=`grep -v READ $x | sed $line_num'q;d' | awk '{print $2 + $3}'`
echo $line_num
line_num=$[$line_num+1]
arr_num=$[$arr_num+1]
done
However, the file to be summed has 270,000+ rows. The script has been running for a few hours now, and it is nowhere near finished. Is there a more efficient way to write this so that it does not take so long?
Use awk instead and take advantage of modulus function:
awk '!(NR%2){print $1+$2}' infile
awk is probably faster, but the idiomatic bash way to do this is something like:
while read -a line; do # read each line one-by-one, into an array
# use arithmetic expansion to add col 1 and 2
echo "$(( ${line[0]} + ${line[1]} ))"
done < <(grep -v READ input.txt)
Note the file input file is only read once (by grep) and the number of externally forked programs is kept to a minimum (just grep, called only once for the whole input file). The rest of the commands are bash builtins.
Using the <( ) process substition, in case variables set in the while loop are required out of scope of the while loop. Otherwise a | pipe could be used.
Your question is pretty verbose, yet your goal is not clear. The way I read it, your numbers are on every second line, and you want only to find the maximum sum. Given that:
awk '
NR%2 == 1 {next}
NR == 2 {max = $1+$2; next}
$1+$2 > max {max = $1+$2}
END {print max}
' filename
You could also use a pipeline with tools that implicitly loop over the input like so:
grep -v read INFILE | tr -s ' ' + | bc | sort -rn | head -1 > OUTFILE
This assumes there are spaces between your read and write data values.
Why not run:
awk 'NR==1 { print "sum"; next } { print $1 + $2 }'
You can afford to run it on the file while the other script it still running. It'll be complete in a few seconds at most (prediction). When you're confident it's right, you can kill the other process.
You can use Perl or Python instead of awk if you prefer.
Your code is running grep, sed and awk on each line of the input file; that's damnably expensive. And it isn't even writing the data to a file; it is creating an array in Bash's memory that'll need to be printed to the output file later.
Assuming that it's always one 'header' row followed by one 'data' row:
awk '
BEGIN{ max = 0 }
{
if( NR%2 == 0 ){
sum = $1 + $2;
if( sum > max ) { max = sum }
}
}
END{ print max }' input.txt
Or simply trim out all lines that do not conform to what you want:
grep '^[0-9]\+\s\+[0-9]\+$' input.txt | awk '
BEGIN{ max = 0 }
{
sum = $1 + $2;
if( sum > max ) { max = sum }
}
END{ print max }' input.txt
I am a biologist that is starting to have to learn some elementary scripting skills to deal with large DNA sequence data sets. So please go easy on me. I am doing this all in bash. I have a file with my data formatted like this:
CLocus_58919_Sample_25_Locus_33235_Allele_0
TGCAGGTGCTTCCAGTTGTCTTTGTAGCGTCCCACCATGATCTGCAGGTCCTTG
CLocus_58919_Sample_9_Locus_54109_Allele_0
TGCAGGTGCTTCCAGTTGTCTTTGTAGCGTCCCACCATGATCTGCAGGTCCTTG
What I need is to do is loop through this file and write all the sequences from the same sample into their own file. Just to be clear, these sequences come from samples 25 and 9. So my idea was to use awk to reformat my file in the following way:
CLocus_58919_Sample_25_Locus_33235_Allele_0_TGCAGGTGCTTCCAGTTGTCTTTGTAGCGTCCCACCATGATCTGCAGGTCCTTG
CLocus_58919_Sample_9_Locus_54109_Allele_0_TGCAGGTGCTTCCAGTTGTCTTTGTAGCGTCCCACCATGATCTGCAGGTCCTTG
then pipe this into another awk if statement to say "if sample=$i then write out that entire line to a file named sample.$i" Here is my code so far:
#!/bin/bash
a=`ls /scratch/tkchafin/data/raw | wc -l`;
b=1;
c=$((a-b));
mkdir /scratch/tkchafin/data/phylogenetics
for ((i=0; i<=$((c)); i++)); do
awk 'ORS=NR%2?"_":"\n"' $1 | awk -F_ '{if($4==$i) print}' >> /scratch/tkchafin/data/phylogenetics/sample.$i
done;
I understand this is not working because $i is in single quotes so bash is not recognizing it. I know awk has a -v option for passing external variables to it, but I don't know how I would apply that in this case. I tried to move the for loop inside the awk statement but this does not produce the desired result either. Any help would be much appreciated.
You can have awk write directly to the desired output file, without a shell loop:
awk -F_ '(NR % 2) == 1 { line1 = $0; fn="/scratch/tkchafin/data/phylogenetics/sample."$4; }
(NR % 2) == 0 { print line1"_"$0 > fn; }' "$1"
But to show how you would use -v in your version, it would be:
for ((i=0; i<=$((c)); i++)); do
awk 'ORS=NR%2?"_":"\n"' $1 | awk -F_ -v i=$i '$4 == i' >> /scratch/tkchafin/data/phylogenetics/sample.$i
done;
I have the following script
awk '{printf "%s", $1"-"$2", "}' $a >> positions;
where $a stores the name of the file. I am actually writing multiple column values into one row. However, I would like to print a comma only if I am not on the last line.
Single pass approach:
cat "$a" | # look, I can use this in a pipeline!
awk 'NR > 1 { printf(", ") } { printf("%s-%s", $1, $2) }'
Note that I've also simplified the string formatting.
Enjoy this one:
awk '{printf t $1"-"$2} {t=", "}' $a >> positions
Yeh, looks a bit tricky at first sight. So I'll explain, first of all let's change printf onto print for clarity:
awk '{print t $1"-"$2} {t=", "}' file
and have a look what it does, for example, for file with this simple content:
1 A
2 B
3 C
4 D
so it will produce the following:
1-A
, 2-B
, 3-C
, 4-D
The trick is the preceding t variable which is empty at the beginning. The variable will be set {t=...} only on the next step of processing after it was shown {print t ...}. So if we (awk) continue iterating we will got the desired sequence.
I would do it by finding the number of lines before running the script, e.g. with coreutils and bash:
awk -v nlines=$(wc -l < $a) '{printf "%s", $1"-"$2} NR != nlines { printf ", " }' $a >>positions
If your file only has 2 columns, the following coreutils alternative also works. Example data:
paste <(seq 5) <(seq 5 -1 1) | tee testfile
Output:
1 5
2 4
3 3
4 2
5 1
Now replacing tabs with newlines, paste easily assembles the date into the desired format:
<testfile tr '\t' '\n' | paste -sd-,
Output:
1-5,2-4,3-3,4-2,5-1
You might think that awk's ORS and OFS would be a reasonable way to handle this:
$ awk '{print $1,$2}' OFS="-" ORS=", " input.txt
But this results in a final ORS because the input contains a newline on the last line. The newline is a record separator, so from awk's perspective there is an empty last record in the input. You can work around this with a bit of hackery, but the resultant complexity eliminates the elegance of the one-liner.
So here's my take on this. Since you say you're "writing multiple column values", it's possible that mucking with ORS and OFS would cause problems. So we can achieve the desired output entirely with formatting.
$ cat input.txt
3 2
5 4
1 8
$ awk '{printf "%s%d-%d",t,$1,$2; t=", "} END{print ""}' input.txt
3-2, 5-4, 1-8
This is similar to Michael's and rook's single-pass approaches, but it uses a single printf and correctly uses the format string for formatting.
This will likely perform negligibly better than Michael's solution because an assignment should take less CPU than a test, and noticeably better than any of the multi-pass solutions because the file only needs to be read once.
Here's a better way, without resorting to coreutils:
awk 'FNR==NR { c++; next } { ORS = (FNR==c ? "\n" : ", "); print $1, $2 }' OFS="-" file file
awk '{a[NR]=$1"-"$2;next}END{for(i=1;i<NR;i++){print a[i]", " }}' $a > positions
I have a file which contents are
E006:Jane:HR:9800:Asst
E005:Bob:HR:5600:Exe
E002:Barney:Purc:2300:PSE
E009:Miffy:Purc:3600:Mngr
E001:Franny:Accts:7670:Mngr
E003:Ostwald:Mrktg:4800:Trainee
E004:Pearl:Accts:1800:SSE
E009:Lala:Mrktg:6566:SE
E018:Popoye:Sales:6400:QAE
E007:Olan:Sales:5800:Asst
I want to fetch List all employees whose emp codes are between E001 and E018 using command including pipes is it possible to get ?
Use sed:
sed -n -e '/^E001:/,/^E018:/p' data.txt
That is, print the lines that are literally between those lines that start with E001 and E018.
If you want to get the employees that are numerically between those, one way to do that would be to do comparisons inline using something like awk (as suggested by hochl). Or, you could take this approach preceded by a sort (if the lines are not already sorted).
sort data.txt | sed -n -e '/^E001:/,/^E018:/p'
You can use awk for such cases:
$ gawk 'BEGIN { FS=":" } /^E([0-9]+)/ { n=substr($1, 2)+0; if (n >= 6 && n <= 18) { print } }' < data.txt
E006:Jane:HR:9800:Asst
E009:Miffy:Purc:3600:Mngr
E009:Lala:Mrktg:6566:SE
E018:Popoye:Sales:6400:QAE
E007:Olan:Sales:5800:Asst
Is that the result you want? This example intentionally only prints employees between 6 and 18 to show that it filters out records. You may print some fields only using $1 or $2 as in print $1 " " $2.
You can try something like this: cut -b2- | awk '{ if ($1 < 18) print "E" $0 }'
Just do string comparison: Since all your sample data matches, I changed the boundaries for illustration
awk -F: '"E004" <= $1 && $1 <= "E009" {print}'
output
E006:Jane:HR:9800:Asst
E005:Bob:HR:5600:Exe
E009:Miffy:Purc:3600:Mngr
E004:Pearl:Accts:1800:SSE
E009:Lala:Mrktg:6566:SE
E007:Olan:Sales:5800:Asst
You can pass the strings as variables if you don't want to hard-code them in the awk script
awk -F: -v start=E004 -v stop=E009 'start <= $1 && $1 <= stop {print}'