Normally I use something like this for processes I run on my servers
./runEvilProcess.sh >> ./evilProcess.log
However I'm currently using Doxygen and it produces lots of duplicate output
Example output:
QGDict::hashAsciiKey: Invalid null key
QGDict::hashAsciiKey: Invalid null key
QGDict::hashAsciiKey: Invalid null key
So you end up with a very messy log
Is there a way I can only add the line to the log file if the line wasn't the last one added.
A poor example (but not sure how to do in bash)
$previousLine = ""
$outputLine = getNextLine()
if($previousLine != $outputLine) {
$outputLine >> logfile.log
$previousLine = $outputLine
}
If the process returns duplicate lines in a row, pipe the output of your process through uniq:
$ ./t.sh
one
one
two
two
two
one
one
$ ./t.sh | uniq
one
two
one
If the logs are sent to the standard error stream, you'll need to redirect that too:
$ ./yourprog 2>&1 | uniq >> logfile
(This won't help if the duplicates come from multiple runs of the program - but then you can pipe your log file through uniq when reviewing it.)
Create a filter script (filter.sh):
while read line; do
if [ "$last" != "$line" ]; then
echo $line
last=$line
fi
done
and use it:
./runEvilProcess.sh | sh filter.sh >> evillog
Related
I have multiple files /text-1.txt, /text-2.txt ... /text-20.txt
and what I want to do is to grep for two patterns and stitch them into one file.
For example:
I have
grep "Int_dogs" /text-1.txt > /text-1-dogs.txt
grep "Int_cats" /text-1.txt> /text-1-cats.txt
cat /text-1-dogs.txt /text-1-cats.txt > /text-1-output.txt
I want to repeat this for all 20 files above. Is there an efficient way in bash/awk, etc. to do this ?
#!/bin/sh
count=1
next () {
[[ "${count}" -lt 21 ]] && main
[[ "${count}" -eq 21 ]] && exit 0
}
main () {
file="text-${count}"
grep "Int_dogs" "${file}.txt" > "${file}-dogs.txt"
grep "Int_cats" "${file}.txt" > "${file}-cats.txt"
cat "${file}-dogs.txt" "${file}-cats.txt" > "${file}-output.txt"
count=$((count+1))
next
}
next
grep has some features you seem not to be aware of:
grep can be launched on lists of files, but the output will be different:
For a single file, the output will only contain the filtered line, like in this example:
cat text-1.txt
I have a cat.
I have a dog.
I have a canary.
grep "cat" text-1.txt
I have a cat.
For multiple files, also the filename will be shown in the output: let's add another textfile:
cat text-2.txt
I don't have a dog.
I don't have a cat.
I don't have a canary.
grep "cat" text-*.txt
text-1.txt: I have a cat.
text-2.txt: I don't have a cat.
grep can be extended to search for multiple patterns in files, using the -E switch. The patterns need to be separated using a pipe symbol:
grep -E "cat|dog" text-1.txt
I have a dog.
I have a cat.
(summary of the previous two points + the remark that grep -E equals egrep):
egrep "cat|dog" text-*.txt
text-1.txt:I have a dog.
text-1.txt:I have a cat.
text-2.txt:I don't have a dog.
text-2.txt:I don't have a cat.
So, in order to redirect this to an output file, you can simply say:
egrep "cat|dog" text-*.txt >text-1-output.txt
Assuming you're using bash.
Try this:
for i in $(seq 1 20) ;do rm -f text-${i}-output.txt ; grep -E "Int_dogs|Int_cats" text-${i}.txt >> text-${i}-output.txt ;done
Details
This one-line script does the following:
Original files are intended to have the following name order/syntax:
text-<INTEGER_NUMBER>.txt - Example: text-1.txt, text-2.txt, ... text-100.txt.
Creates a loop starting from 1 to <N> and <N> is the number of files you want to process.
Warn: rm -f text-${i}-output.txt command first will be run and remove the possible outputfile (if there is any), to ensure that a fresh new output file will be only available at the end of the process.
grep -E "Int_dogs|Int_cats" text-${i}.txt will try to match both strings in the original file and by >> text-${i}-output.txt all the matched lines will be redirected to a newly created output file with the relevant number of the original file. Example: if integer number in original file is 5 text-5.txt, then text-5-output.txt file will be created & contain the matched string lines (if any).
I am trying to write a script which takes a directory containing text files (384 of them) and modifies duplicate lines that have a specific format in order to make them not duplicates.
In particular, I have files in which some lines begin with the '#' character and contain the substring 0:0. A subset of these lines are duplicated one or more times. For those that are duplicated, I'd like to replace 0:0 with i:0 where i starts at 1 and is incremented.
So far I've written a bash script that finds duplicated lines beginning with '#', writes them to a file, then reads them back and uses sed in a while loop to search and replace the first occurrence of the line to be replaced. This is it below:
#!/bin/bash
fdir=$1"*"
#for each fastq file
for f in $fdir
do
(
#find duplicated read names and write to file $f.txt
sort $f | uniq -d | grep ^# > "$f".txt
#loop over each duplicated readname
while read in; do
rname=$in
i=1
#while this readname still exists in the file increment and replace
while grep -q "$rname" $f; do
replace=${rname/0:0/$i:0}
sed -i.bu "0,/$rname/s/$rname/$replace/" "$f"
let "i+=1"
done
done < "$f".txt
rm "$f".txt
rm "$f".bu
done
echo "done" >> progress.txt
)&
background=( $(jobs -p) )
if (( ${#background[#]} ==40)); then
wait -n
fi
done
The problem with it is that its impractically slow. I ran it on a 48 core computer for over 3 days and it hardly got through 30 files. It also seemed to have removed about 10 files and I'm not sure why.
My question is where are the bugs coming from and how can I do this more efficiently? I'm open to using other programming languages or changing my approach.
EDIT
Strangely the loop works fine on one file. Basically I ran
sort $f | uniq -d | grep ^# > "$f".txt
while read in; do
rname=$in
i=1
while grep -q "$rname" $f; do
replace=${rname/0:0/$i:0}
sed -i.bu "0,/$rname/s/$rname/$replace/" "$f"
let "i+=1"
done
done < "$f".txt
To give you an idea of what the files look like below are a few lines from one of them. The thing is that even though it works for the one file, it's slow. Like multiple hours for one file of 7.5 M. I'm wondering if there's a more practical approach.
With regard to the file deletions and other bugs I have no idea what was happening Maybe it was running into memory collisions or something when they were run in parallel?
Sample input:
#D00269:138:HJG2TADXX:2:1101:0:0 1:N:0:CCTAGAAT+ATTCCTCT
GATAAGGACGGCTGGTCCCTGTGGTACTCAGAGTATCGCTTCCCTGAAGA
+
CCCFFFFFHHFHHIIJJJJIIIJJIJIJIJJIIBFHIHIIJJJJJJIJIG
#D00269:138:HJG2TADXX:2:1101:0:0 1:N:0:CCTAGAAT+ATTCCTCT
CAAGTCGAACGGTAACAGGAAGAAGCTTGCTTCTTTGCTGACGAGTGGCG
Sample output:
#D00269:138:HJG2TADXX:2:1101:1:0 1:N:0:CCTAGAAT+ATTCCTCT
GATAAGGACGGCTGGTCCCTGTGGTACTCAGAGTATCGCTTCCCTGAAGA
+
CCCFFFFFHHFHHIIJJJJIIIJJIJIJIJJIIBFHIHIIJJJJJJIJIG
#D00269:138:HJG2TADXX:2:1101:2:0 1:N:0:CCTAGAAT+ATTCCTCT
CAAGTCGAACGGTAACAGGAAGAAGCTTGCTTCTTTGCTGACGAGTGGCG
Here's some code that produces the required output from your sample input.
Again, it is assumed that your input file is sorted by the first value (up to the first space character).
time awk '{
#dbg if (dbg) print "#dbg:prev=" prev
if (/^#/ && prev!=$1) {fixNum=0 ;if (dbg) print "prev!=$1=" prev "!=" $1}
if (/^#/ && (prev==$1 || NR==1) ) {
prev=$1
n=split($1,tmpArr,":") ; n++
#dbg if (dbg) print "tmpArr[6]="tmpArr[6] "\tfixNum="fixNum
fixNum++;tmpArr[6]=fixNum;
# magic to rebuild $1 here
for (i=1;i<n;i++) {
tmpFix ? tmpFix=tmpFix":"tmpArr[i]"" : tmpFix=tmpArr[i]
}
$1=tmpFix ; $0=$0
print $0
}
else { tmpFix=""; print $0 }
}' file > fixedFile
output
#D00269:138:HJG2TADXX:2:1101:1:0 1:N:0:CCTAGAAT+ATTCCTCT
GATAAGGACGGCTGGTCCCTGTGGTACTCAGAGTATCGCTTCCCTGAAGA
+
CCCFFFFFHHFHHIIJJJJIIIJJIJIJIJJIIBFHIHIIJJJJJJIJIG
#D00269:138:HJG2TADXX:2:1101:2:0 1:N:0:CCTAGAAT+ATTCCTCT
CAAGTCGAACGGTAACAGGAAGAAGCTTGCTTCTTTGCTGACGAGTGGCG
I've left a few of the #dbg:... statements in place (but they are now commented out) to show how you can run a small set of data as you have provided, and watch the values of variables change.
Assuming a non-csh, you should be able to copy/paste the code block into a terminal window cmd-line and replace file > fixFile at the end with your real file name and a new name for the fixed file. Recall that awk 'program' file > file (actually, any ...file>file) will truncate the existing file and then try to write, SO you can lose all the data of a file trying to use the same name.
There are probably some syntax improvements that will reduce the size of this code, and there might be 1 or 2 things that could be done that will make the code faster, but this should run very quickly. If not, please post the result of time command that should appear at the end of the run, i.e.
real 0m0.18s
user 0m0.03s
sys 0m0.06s
IHTH
#!/bin/bash
i=4
sort $1 | uniq -d | grep ^# > dups.txt
while read in; do
if [ $((i%4))=0 ] && grep -q "$in" dups.txt; then
x="$in"
x=${x/"0:0 "/$i":0 "}
echo "$x" >> $1"fixed.txt"
else
echo "$in" >> $1"fixed.txt"
fi
let "i+=1"
done < $1
{
while read -r line ; do
if grep -q '2015' $line
then
echo "inside then"
echo "$line"
echo "yes"
fi
done
} < testinput
Once I execute the above code the output is:
inside then
( nothing is printed in this line its spaces)
yes
Why is that input line is not getting printed in the second output line?
Your help is appreciated. The reason why I am asking is that I actually have to perform a few operations on the input line after the match using grep is successful.
Input file Sample :
2015-07-18-00.07.28.991321-240 I84033A497 LEVEL: Info
PID : 21233902 TID : 9510 PROC : db2sysc 0
INSTANCE: xxxxxxxx NODE : 000 DB : XXXXXXX
APPHDL : 0-8 APPID: *LOCAL.xxxxxxx.150718040727
AUTHID : XXXXXXXX
EDUID : 9510 EDUNAME: db2agent (XXXXXXXX) 0
FUNCTION: DB2 Common, SQLHA APIs for DB2 HA Infrastructure
I need to capture the time when SQLHA shows up in the input file or log file. To do that first I find the match for time in the input file and then I save that time in the variables. Once I find SQLHA I will write the time saved in the variables into an output file. So for every occurrence of SQLHA in the log, I will write the time to the output file.
After the update about what is really wanted, it is fairly clear that
you should probably use awk, though sed would also be an option (but harder). You can do it in shell too, though that's messier.
awk '/^2015-/ { datetime = $1 } / SQLHA / { print datetime }' testinput
Using sed:
sed -n -e '/^2015-/ {s/ .*//; h; n; }' -e '/ SQLHA / { x; p; x; }' testinput
(If you find 2015- at the start of a line, remove the stuff after a space and save it in the hold space. If you find SQLHA with spaces on either side, swap the hold and pattern space (thus placing the saved date/time in the pattern space), then print it, then switch it back. The switch back means that if two lines contain SQLHA between occurrences of the date line, you'll get the same date printed twice, rather than a date and then the first of the SQLHA lines. You end up having to think about what can go wrong, as well as what to do when everything goes right — but that may be more for later than right now.)
Using just sh:
while read -r line
do
case "$line" in
(2015-*) datetime=$(set -- $line; echo $1);; # Absence of quotes is deliberate
(*SQLHA*) echo "$datetime";;
esac
done < testinput
There are many other ways to do that in shell. Some of them are safer than this. It'll work on the data shown safely, but you might get to run against maliciously created data.
while read -r line
do
case "$line" in
(2015-*) datetime=$(echo "$line" | sed 's/ .*//');;
(*SQLHA*) echo "$datetime";;
esac
done < testinput
This invokes sed once per date line. Using Bash, I guess you can use:
while read -r line
do
case "$line" in
(2015-*) datetime="${line/ */}";; # Replace blank and everything after with nothing
(*SQLHA*) echo "$datetime";;
esac
done < testinput
This is the least likely to go wrong and avoids executing an external command for each line. You could also avoid case…esac using if and probably [[ so as to get pattern matching. Etc.
Running your script on a Mac, I get error output such as:
grep: 2015-07-18-00.07.28.991321-240: No such file or directory
grep: I84033A497: No such file or directory
grep: LEVEL:: No such file or directory
Are you not seeing that? If you're not, then either you've sent errors to /dev/null (or some other location than the terminal) or you've not shown us exactly the code you're using — or there's a blank line at the top of your testinput file.
This will do what your script is trying to do:
#!/usr/bin/awk -f
/2015/ {
print "inside then"
print
print "yes"
}
This is what I have written(very basic).I will try to run the same program with Grep and post why i am getting the blank space soon.
while read -r line
do
if [[ $line == *2015* ]];
then
dtime=`echo $line | cut -c1-26`
fi
if [[ $line == *SQLHA* ]];
then
echo $dtime
fi
done
} < testinput
Input Used:
2015-07-18-00.07.28.991321-240 I84033A497 LEVEL: Info
EDUID : 9510 EDUNAME: db2agent (SIEB_RPT) 0
FUNCTION: DB2 Common,APIs for DB2 HA Infrastructure, sqlhaAmIin
2015-07-18-00.07.29.991321-240 I84033A497 LEVEL: Info
FUNCTION: DB2 Common, SQLHA APIs for DB2 HA Infrastructure, sqlha
2015-07-18-00.07.48.991321-240 I84033A497 LEVEL: Info
EDUID : 9510 EDUNAME: db2agent (SIEB_RPT) 0
FUNCTION: DB2 Common, SQLHA APIs for DB2 HA Infrastructure, sqlha
O/p :
2015-07-18-00.07.29.991321
2015-07-18-00.07.48.991321
I am trying to write a shell which will take an SQL file as input. Example SQL file:
SELECT *
FROM %%DB.TBL_%%TBLEXT
WHERE CITY = '%%CITY'
Now the script should extract all variables, which in this case everything starting with %%. So the output file will be something as below:
%%DB
%%TBLEXT
%%CITY
Now I should be able to extract the matching values from the user's .profile file for these variables and create the SQL file with the proper values.
SELECT *
FROM tempdb.TBL_abc
WHERE CITY = 'Chicago'
As of now I am trying to generate the file1 which will contain all the variables. Below code sample -
sed "s/[(),']//g" "T:/work/shell/sqlfile1.sql" | awk '/%%/{print $NF}' | awk '/%%/{print $NF}' > sqltemp2.sql
takes me till
%%DB.TBL_%%TBLEXT
%%CITY
Can someone help me in getting to file1 listing the variables?
You can use grep and sort to get a list of unique variables, as per the following transcript:
$ echo "SELECT *
FROM %%DB.TBL_%%TBLEXT
WHERE CITY = '%%CITY'" | grep -o '%%[A-Za-z0-9_]*' | sort -u
%%CITY
%%DB
%%TBLEXT
The -o flag to grep instructs it to only print the matching parts of lines rather than the entire line, and also outputs each matching part on a distinct line. Then sort -u just makes sure there are no duplicates.
In terms of the full process, here's a slight modification to a bash script I've used for similar purposes:
# Define all translations.
declare -A xlat
xlat['%%DB']='tempdb'
xlat['%%TBLEXT']='abc'
xlat['%%CITY']='Chicago'
# Check all variables in input file.
okay=1
for key in $(grep -o '%%[A-Za-z0-9_]*' input.sql | sort -u) ; do
if [[ "${xlat[$key]}" == "" ]] ; then
echo "Bad key ($key) in file:"
grep -n "${key}" input.sql | sed 's/^/ /'
okay=0
fi
done
if [[ ${okay} -eq 0 ]] ; then
exit 1
fi
# Process input file doing substitutions. Fairly
# primitive use of sed, must change to use sed -i
# at some point.
# Note we sort keys based on descending length so we
# correctly handle extensions like "NAME" and "NAMESPACE",
# doing the longer ones first makes it work properly.
cp input.sql output.sql
for key in $( (
for key in ${!xlat[#]} ; do
echo ${key}
done
) | awk '{print length($0)":"$0}' | sort -rnu | cut -d':' -f2) ; do
sed "s/${key}/${xlat[$key]}/g" output.sql >output2.sql
mv output2.sql output.sql
done
cat output.sql
It first checks that the input file doesn't contain any keys not found in the translation array. Then it applies sed substitutions to the input file, one per translation, to ensure all keys are substituted with their respective values.
This should be a good start, though there may be some edge cases such as if your keys or values contain characters sed would consider important (like / for example). If that is the case, you'll probably need to escape them such as changing:
xlat['%%UNDEFINED']='0/0'
into:
xlat['%%UNDEFINED']='0\/0'
How to I concatenate stdin to a string, like this?
echo "input" | COMMAND "string"
and get
inputstring
A bit hacky, but this might be the shortest way to do what you asked in the question (use a pipe to accept stdout from echo "input" as stdin to another process / command:
echo "input" | awk '{print $1"string"}'
Output:
inputstring
What task are you exactly trying to accomplish? More context can get you more direction on a better solution.
Update - responding to comment:
#NoamRoss
The more idiomatic way of doing what you want is then:
echo 'http://dx.doi.org/'"$(pbpaste)"
The $(...) syntax is called command substitution. In short, it executes the commands enclosed in a new subshell, and substitutes the its stdout output to where the $(...) was invoked in the parent shell. So you would get, in effect:
echo 'http://dx.doi.org/'"rsif.2012.0125"
use cat - to read from stdin, and put it in $() to throw away the trailing newline
echo input | COMMAND "$(cat -)string"
However why don't you drop the pipe and grab the output of the left side in a command substitution:
COMMAND "$(echo input)string"
I'm often using pipes, so this tends to be an easy way to prefix and suffix stdin:
echo -n "my standard in" | cat <(echo -n "prefix... ") - <(echo " ...suffix")
prefix... my standard in ...suffix
There are some ways of accomplish this, i personally think the best is:
echo input | while read line; do echo $line string; done
Another can be by substituting "$" (end of line character) with "string" in a sed command:
echo input | sed "s/$/ string/g"
Why i prefer the former? Because it concatenates a string to stdin instantly, for example with the following command:
(echo input_one ;sleep 5; echo input_two ) | while read line; do echo $line string; done
you get immediatly the first output:
input_one string
and then after 5 seconds you get the other echo:
input_two string
On the other hand using "sed" first it performs all the content of the parenthesis and then it gives it to "sed", so the command
(echo input_one ;sleep 5; echo input_two ) | sed "s/$/ string/g"
will output both the lines
input_one string
input_two string
after 5 seconds.
This can be very useful in cases you are performing calls to functions which takes a long time to complete and want to be continuously updated about the output of the function.
You can do it with sed:
seq 5 | sed '$a\6'
seq 5 | sed '$ s/.*/\0 6/'
In your example:
echo input | sed 's/.*/\0string/'
I know this is a few years late, but you can accomplish this with the xargs -J option:
echo "input" | xargs -J "%" echo "%" "string"
And since it is xargs, you can do this on multiple lines of a file at once. If the file 'names' has three lines, like:
Adam
Bob
Charlie
You could do:
cat names | xargs -n 1 -J "%" echo "I like" "%" "because he is nice"
Also works:
seq -w 0 100 | xargs -I {} echo "string "{}
Will generate strings like:
string 000
string 001
string 002
string 003
string 004
...
The command you posted would take the string "input" use it as COMMAND's stdin stream, which would not produce the results you are looking for unless COMMAND first printed out the contents of its stdin and then printed out its command line arguments.
It seems like what you want to do is more close to command substitution.
http://www.gnu.org/software/bash/manual/html_node/Command-Substitution.html#Command-Substitution
With command substitution you can have a commandline like this:
echo input `COMMAND "string"`
This will first evaluate COMMAND with "string" as input, and then expand the results of that commands execution onto a line, replacing what's between the ‘`’ characters.
cat will be my choice: ls | cat - <(echo new line)
With perl
echo "input" | perl -ne 'print "prefix $_"'
Output:
prefix input
A solution using sd (basically a modern sed; much easier to use IMO):
# replace '$' (end of string marker) with 'Ipsum'
# the `e` flag disables multi-line matching (treats all lines as one)
$ echo "Lorem" | sd --flags e '$' 'Ipsum'
Lorem
Ipsum#no new line here
You might observe that Ipsum appears on a new line, and the output is missing a \n. The reason is echo's output ends in a \n, and you didn't tell sd to add a new \n. sd is technically correct because it's doing exactly what you are asking it to do and nothing else.
However this may not be what you want, so instead you can do this:
# replace '\n$' (new line, immediately followed by end of string) by 'Ipsum\n'
# don't forget to re-add the `\n` that you removed (if you want it)
$ echo "Lorem" | sd --flags e '\n$' 'Ipsum\n'
LoremIpsum
If you have a multi-line string, but you want to append to the end of each individual line:
$ ls
foo bar baz
$ ls | sd '\n' '/file\n'
bar/file
baz/file
foo/file
I want to prepend my sql script with "set" statement before running it.
So I echo the "set" instruction, then pipe it to cat. Command cat takes two parameters : STDIN marked as "-" and my sql file, cat joins both of them to one output. Next I pass the result to mysql command to run it as a script.
echo "set #ZERO_PRODUCTS_DISPLAY='$ZERO_PRODUCTS_DISPLAY';" | cat - sql/test_parameter.sql | mysql
p.s. mysql login and password stored in .my.cnf file