I have a bunch of files in the following format.
A.txt:
some text1
more text2
XXX
more text
....
XXX
.
.
XXX
still more text
text again
Each file has at least 3 lines that start with XXX. Now, for each file A.txt I want to write all the lines till the 3rd occurrence of XXX (in the above example it is till the line before still more text) to file A_modified.txt.
I want to do this in bash and came up with grep -n -m 3 -w "^XXX$" * | cut -d: -f2 to get the corresponding line number in each file.
Is is possible to use head along with these line numbers to generate the required output?
PS: I know a simple python script would do the job but I am trying to do in this bash for no specific reason.
A simpler method would be to use awk. Assuming there's nothing but files of interest in your present working directory, try:
for i in *; do awk '/^XXX$/ { c++ } c<=3' "$i" > "$i.modified"; done
Or if your files are very big:
for i in *; do awk '/^XXX$/ { c++ } c>=3 { exit }1' "$i" > "$i.modified"; done
head -n will print out the first 'n' lines of the file
#!/bin/sh
for f in `ls *.txt`; do
echo "searching $f"
line_number=`grep -n -m 3 -w "^XXX$" $f | cut -d: -f1 | tail -1`
# line_number now stores the line of the 3rd XXX
# now dump out the first 'line_number' of lines from this file
head -n $line_number $f
done
Related
I wrote a script to change specific lines in one text files (fasta format) and I want to parallelize because there is a lot of lines (~800k).
>CTC14_37541|M00842:336:000000000-C7WWK:1:2101:20913:9309:0:66|o:97|mo:0.000000|MR:n=0;r1=0;r2=0|Q30:p=75;p=71|CO
And I want to transform it to:
>Sample-CTC14_Read37541
I have two problems.
I tried to run my script with and without function:
Without function, it works: all the lines I want to change are modified.
When I use a function, only one line is modified. Something is wrong in my function header()?
Second problem is the parallelization. I tried something with "&" but I'm not sure that is the best solution. Any idea?
My code without function and parallel:
#!/bin/bash
TMP_PATH="/path/where/is/my/fasta"
cd $TMP_PATH
for fasta in *.fasta
do
echo $fasta
lines=$(grep ">" $fasta)
for line in $lines
do
if [[ $line = *">"* ]]; then
read_nb="_Read"$(echo $line | cut -d'|' -f1 | cut -d'_' -f2)
sample=$(echo $line | cut -d'_' -f1 | cut -d'>' -f2)
newheader=$(echo ">Sample-$sample$read_nb")
sed -i -e "s/$line/$newheader/g" $fasta
sed -i -e "s/ /\n/g" $fasta
fi
done
done
echo "END"
My code with function and parallel:
#!/bin/bash
TMP_PATH="/path/where/is/my/fasta"
cd $TMP_PATH
n=0
maxjobs=500
header(){
if [[ $line = *">"* ]]; then
read_nb="_Read"$(echo $line | cut -d'|' -f1 | cut -d'_' -f2)
sample=$(echo $line | cut -d'_' -f1 | cut -d'>' -f2)
newheader=$(echo ">Sample-$sample$read_nb")
sed -i -e "s/$line/$newheader/g" $fasta
sed -i -e "s/ /\n/g" $fasta
fi
}
for fasta in *.fasta
do
lines=$(grep ">" $fasta)
for line in $lines
do
header $line &
#limit jobs
if (( $(($((++n)) % $maxjobs)) == 0 )) ; then
wait
echo $n wait
fi
done
done
I have a fasta file as input that contains several headers and sequences. And I want to transform headers in order to use my fasta file in a specific workflow. I need to go from that :
>CTC14_18758|M00842:336:000000000-C7WWK:1:1108:17474:5670:0:66|o:98|mo:0.000000|MR:n=0;r1=0;r2=0|Q30:p=66;p=62|CO:0|
TGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCATGAGTGAAGAAGGCCTTTGGGTTGTAAAGCTCTTTTAGTGAGGAAGATAATGACGGTACTCACAGAAGAAGTCCTGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGAGGGCTAGCGTTATTCGGAATTATTGGGCGTAAAGGGCGCGTAGGCTGGTTAATAAGTTAAAAGTGAAATCCCGAGGCTTAACCTTGGAATTGCTTTTAAAACTATTAATCTAGAGATTGAAAGAGGATAGAGGAATTCCTGATGTAGAGGTAAAATTCGTAAATATTAGGAGGAACACCAGCGGCGAAGGCGTCTATCTGGTTCAAATCTGACGCTGAAGCGCGAAGGCTTGGGGAGCAAACAGG
>CTC14_20535|M00842:336:000000000-C7WWK:1:1108:28568:20175:0:66|o:97|mo:0.000000|MR:n=0;r1=0;r2=0|Q30:p=77;p=64|CO:0|
TGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCATGAGTGAAGAAGGCCTTTGGGTTGTAAAGCTCTTTTAGTGAGGAAGATAATGACGGTACCCACAGAAGAAGTCCTGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGAGGGCTAGCGTTATTCGGAATTATTGGGCGTAAAGGGCGCGTAGGCTGGTTAATAAGTTAAAAGTGAAATCCCGAGGCTTAACCTTGGAATTGCTTTTAAAACTATTAATCTAGAGATTGAAAGAGGATAGAGGAATTCCTGATGTAGAGGTAAAATTCGTAAATATTAGGAGGAACACCAGTGGCGAAGGCGTCTATCTGGTTCAAATCTGACGCTGAAGCGCGAAGGCGTGGGGAGCAAACAGG
>CTC14_24700|M00842:336:000000000-C7WWK:1:1110:7911:9824:0:66|o:97|mo:0.000000|MR:n=0;r1=0;r2=0|Q30:p=77;p=71|CO:0|
TGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCATGAGTGAAGAAGGCCTTTGGGTTGTAAAGCTCTTTTAGTGAGGAAGATAATGACGGTACTCACAGAAGAAGTCCTGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGAGGGCTAGCGTTATTCGGAATTATTGGGCGTAAAGGGCGCGTAGGCTGGTTAATAAGTTAAAAGTGAAATCCCGAGGCTTAACCTTGGAATTGCTTTTAAAACTATTAATCTAGAGATTGAAAGAGGATAGAGGAATTCCTGATGTAGAGGTAAAATTCGTAAATATTAGGAGGAACACCAGTGGCGAAGGCGTCTATCTGGTTCAAATCTGACGCTGAAGCGCGAAGGCGTGGGGAGCAAACAGG
To this:
>Sample-CTC14_Read18758
TGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCATGAGTGAAGAAGGCCTTTGGGTTGTAAAGCTCTTTTAGTGAGGAAGATAATGACGGTACTCACAGAAGAAGTCCTGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGAGGGCTAGCGTTATTCGGAATTATTGGGCGTAAAGGGCGCGTAGGCTGGTTAATAAGTTAAAAGTGAAATCCCGAGGCTTAACCTTGGAATTGCTTTTAAAACTATTAATCTAGAGATTGAAAGAGGATAGAGGAATTCCTGATGTAGAGGTAAAATTCGTAAATATTAGGAGGAACACCAGCGGCGAAGGCGTCTATCTGGTTCAAATCTGACGCTGAAGCGCGAAGGCTTGGGGAGCAAACAGG
>Sample-CTC14_Read20535
TGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCATGAGTGAAGAAGGCCTTTGGGTTGTAAAGCTCTTTTAGTGAGGAAGATAATGACGGTACCCACAGAAGAAGTCCTGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGAGGGCTAGCGTTATTCGGAATTATTGGGCGTAAAGGGCGCGTAGGCTGGTTAATAAGTTAAAAGTGAAATCCCGAGGCTTAACCTTGGAATTGCTTTTAAAACTATTAATCTAGAGATTGAAAGAGGATAGAGGAATTCCTGATGTAGAGGTAAAATTCGTAAATATTAGGAGGAACACCAGTGGCGAAGGCGTCTATCTGGTTCAAATCTGACGCTGAAGCGCGAAGGCGTGGGGAGCAAACAGG
>Sample-CTC14_Read24700
TGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCATGAGTGAAGAAGGCCTTTGGGTTGTAAAGCTCTTTTAGTGAGGAAGATAATGACGGTACTCACAGAAGAAGTCCTGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGAGGGCTAGCGTTATTCGGAATTATTGGGCGTAAAGGGCGCGTAGGCTGGTTAATAAGTTAAAAGTGAAATCCCGAGGCTTAACCTTGGAATTGCTTTTAAAACTATTAATCTAGAGATTGAAAGAGGATAGAGGAATTCCTGATGTAGAGGTAAAATTCGTAAATATTAGGAGGAACACCAGTGGCGAAGGCGTCTATCTGGTTCAAATCTGACGCTGAAGCGCGAAGGCGTGGGGAGCAAACAGG
And I want to make this parallel because I have a lot of lines to change (~700-800k) and it takes very long time if I run the script line by line.
With my script without function, job is works but it's too long.
With my script with function and parallel, job doesn't work fine because only one header is changed in my fasta instead of all headers and I don't understand why. I tried different ways to write and call my function but the result is always the same.
Moreover, I tried with the gnu-parallel but it's the same way. I think my function or my call have a problem but I don't understand where.
I think use awk as you suggested is a good idea but I'm not comfortable with it. Can you help me please?
Proper format of my fasta file is:
>CTC14_1600|M00842:336:000000000-C7WWK:1:1101:26089:18004:0:66|o:97|mo:0.000000|MR:n=0;r1=0;r2=0|Q30:p=77;p=71|CO:0| TGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCATGAGTGAAGAAGGCCTTTGGGTTGTAAAGCTCTTTTAGTGAGGAAGATAATGACGGTACTCACAGAAGAAGTCCTGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGAGGGCTAGCGTTATTCGGAATTATTGGGCGTAAAGGGCGCGTAGGCTGGTTAATAAGTTAAAAGTGAAATCCCGAGGCTTAACCTTGGAATTGCTTTTAAAACTATTAATCTAGAGATTGAAAGAGGATAGAGGAATTCCTGACGTAGAGGTAAAATTCGTAAATATTAGGAGGAACACCAGTGGCGAAGGCGTCTATCTGGTTCAAATCTGACGCTGAAGCGCGAAGGCGTGGGGAGCAAACAGG$
>CTC14_11169|M00842:336:000000000-C7WWK:1:1105:11636:11876:0:66|o:97|mo:0.000000|MR:n=0;r1=0;r2=0|Q30:p=76;p=65|CO:0| TGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCATGAGTGAAGAAGGCCTTTGGGTTGTAAAGCTCTTTTAGTGAGGAAGATAATGACGGTACTCACAGAAGAAGTCCTGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGAGGGCTAGCGTTATTCGGAATTATTGGGCGTAAAGGGCGCGTAGGCTGGTTAATAAGTTAAAAGTGAAATCCCGAGGCTTAACCTTGGAATTGCTTTTAAAACTATTAATCTAGAGATTGAAAGAGGATAGAGGAATTCCTGATGTAGAGGTAAAATTCGTAAATATTAGGAGGAACACCAGTGGCGAAGGCGTCTATCTGGTTCAAATCTGACGCTGAAGCGCGAAGGCGTGGGGAGCAAACAGG$
>CTC14_16471|M00842:336:000000000-C7WWK:1:1107:6941:10486:0:66|o:97|mo:0.000000|MR:n=0;r1=0;r2=0|Q30:p=77;p=70|CO:0| TGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCATGAGTGAAGAAGGCCTTTGGGTTGTAAAGCTCTTTTAGTGAGGAAGATAATGGCGGTACTCACAGAAGAAGTCCTGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGAGGGCTAGCGTTATTCGGAATTATTGGGCGTAAAGGGCGCGTAGGCTGGTTAATAAGTTAAAAGTGAAATCCCGAGGCTTAACCTTGGAATTGCTTTTAAAGCTATTAATCTAGAGATTGAAAGAGGATAGAGGAATTCCTGATGTAGAGGTAAAATTCGTGAATATTAGGAGGAACACCAGTGGCGAAGGCGTCTATCTGGTTCAAATCTGACGCTGAAGCGCGAAGGCGTGGGGAGCAAACAGG$
Assuming that >CTC14_18758|M00842:336:000000000- is on a separate line, this code will convert the input to the output.
#!/bin/sed -f
#skip blank lines
/^[[:space:]]*$/n
#change >CTC14_18758|M00842:336:000000000-
# to >Sample-CTC14_Read18758
s/^>/>Sample-/
s/_/_Read/
/^>/s/|.*$//
# remove 2ndary header
# C7WWK:1:1108:17474:5670:0:66|o:98|mo:0.000000|MR:n=0;r1=0;r2=0|Q30:p=66;p=62|CO:0| TGGGGAATATTGGAC...
# to
# TGGGGAATATTGGAC...
s/^[^>].*| //
Save that as a file/script.
Then mark it as executable with
chmod +x mySed
and run it like
./mySed -i fileIn
Or if you get an warning/error message about -i, then run
./mySed fileIn > fileOut && mv fileOut fileIn
Now you can eliminate your function header(), and the 2ndary loop in your code.
Just
for file in *.fasta ; do
echo "processing file=$file"
/path/to/mySed -i "$file"
# run other processing if needed
# don't think you need wait any more
#uncomment? wait
done
-------------- version 2 sed ---------------
#!/bin/sed -f
#skip blank lines
/^[[:space:]]*$/n
#>CTC14_18758|M00842:336:000000000-C7WWK:1:1108:17474:5670:0:66|o:98|mo:0.000000|MR:n=0;r1=0;r2=0|Q30:p=66;p=62|CO:0| TGGGGA...
#change >CTC14_18758|M00842:336:000000000-
# to >Sample-CTC14_Read18758
s/^>/>Sample-/
s/_/_Read/
s/|.*| / /
# /^>/s/-.*| / /
# s/-.*| / /
works with data like
>CTC14_16471|M00842:336:000000000-C7WWK:1:1107:6941:10486:0:66|o:97|mo:0.000000|MR:n=0;r1=0;r2=0|Q30:p=77;p=70|CO:0| TGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCATGAGTGAAGAAGGCCTTTGGGTTGTAAAGCTCTTTTAGTGAGGAAGATAATGGCGGTACTCACAGAAGAAGTCCTGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGAGGGCTAGCGTTATTCGGAATTATTGGGCGTAAAGGGCGCGTAGGCTGGTTAATAAGTTAAAAGTGAAATCCCGAGGCTTAACCTTGGAATTGCTTTTAAAGCTATTAATCTAGAGATTGAAAGAGGATAGAGGAATTCCTGATGTAGAGGTAAAATTCGTGAATATTAGGAGGAACACCAGTGGCGAAGGCGTCTATCTGGTTCAAATCTGACGCTGAAGCGCGAAGGCGTGGGGAGCAAACAGG
IHTH
There are some data files being imported with header names on the first row and others dont have headers. The ones that are with headers are having always "company" as first field on the first row. For loading them into DB I need to get rid of the first row. So I need to write .sh scrict that deletes first row only of those files that have first column first row="company". I guess I need to combine awk with if statement but I dont know exactly how.
if head -n 1 input.csv | cut -f 1 -d ',' | grep company
then tail -n +2 input.csv > output.csv
else
cp input.csv output.csv
fi
If you're sure the string "company" appears only as 1st field on headers, you can go this way
sed -e /^company,/d oldfile > newfile
supposing the separator is a comma.
Another solution :
if [ head -1 oldfile | grep -q "^company,"] ; then
sed -e 1d oldfile > newfile
else
cp oldfile newfile
fi
No if needed. Just do it straight forward as you stated your requirements:
Print the first line unless it starts with company:
strip_header_if_present() {
IFS='' read -r first_line
echo "$first_line" | grep -v ^company,
Now print the remaining lines:
cat
}
To use this shell function:
strip_header_if_present < input.csv > output.csv
I would like to remove a file name only from the following configuration file.
Configuration File -- test.conf
knowledgebase/arun/test.rf
knowledgebase/arunraj/tester/test.drl
knowledgebase/arunraj2/arun/test/tester.drl
The above file should be read. And removed contents should went to another file called output.txt
Following are my try. It is not working to me at all. I am getting empty files only.
#!/bin/bash
file=test.conf
while IFS= read -r line
do
# grep --exclude=*.drl line
# awk 'BEGIN {getline line ; gsub("*.drl","", line) ; print line}'
# awk '{ gsub("/",".drl",$NF); print line }' arun.conf
# awk 'NF{NF--};1' line arun.conf
echo $line | rev | cut -d'/' -f 1 | rev >> output.txt
done < "$file"
Expected Output :
knowledgebase/arun
knowledgebase/arunraj/tester
knowledgebase/arunraj2/arun/test
There's the dirname command to make it easy and reliable:
#!/bin/bash
file=test.conf
while IFS= read -r line
do
dirname "$line"
done < "$file" > output.txt
There are Bash shell parameter expansions that will work OK with the list of names given but won't work reliably for some names:
file=test.conf
while IFS= read -r line
do
echo "${line%/*}"
done < "$file" > output.txt
There's sed to do the job — easily with the given set of names:
sed 's%/[^/]*$%%' test.conf > output.txt
It's harder if you have to deal with names like /plain.file (or plain.file — the same sorts of edge cases that trip up the shell expansion).
You could add Perl, Python, Awk variants to the list of ways of doing the job.
You can get the path like this:
path=${fullpath%/*}
It cuts away the string after the last /
Using awk one liner you can do this:
awk 'BEGIN{FS=OFS="/"} {NF--} 1' test.conf
Output:
knowledgebase/arun
knowledgebase/arunraj/tester
knowledgebase/arunraj2/arun/test
I would like to count the copies of each line in a txt file and I have tried so many things until know, but none worked well. In my case the text has just a word in each line.
This was my last try
echo -n 'enter file for edit: '
read file
for line in $file ; do
echo 'grep -w $line $file'
done; <$file
For example:
input file
a
a
a
c
c
Output file
a 3
c 2
Thanks in advance.
$ sort < $file | uniq -c | awk '{print $2 " " $1}'
I have number of files which have similar names like
DWH_Export_AUSTA_20120701_20120731_v1_1.csv.397.dat.2012-10-02 04-01-46.out
DWH_Export_AUSTA_20120701_20120731_v1_2.csv.397.dat.2012-10-02 04-03-12.out
DWH_Export_AUSTA_20120801_20120831_v1_1.csv.397.dat.2012-10-02 04-04-16.out
etc.
I need to get number before .csv(1 or 2) from the file name and put it into end of every line in file with TAB separator.
I have written this code, it finds number that I need, but i do not know how to put this number into file. There is space in the filename, my script breaks because of it.
Also I am not sure, how to send to script list of files. Now I am working only with one file.
My code:
#!/bin/sh
string="DWH_Export_AUSTA_20120701_20120731_v1_1.csv.397.dat.2012-10-02 04-01-46.out"
out=$(echo $string | awk 'BEGIN {FS="_"};{print substr ($7,0,1)}')
awk ' { print $0"\t$out" } ' $string
for file in *
do
sfx=$(echo "$file" | sed 's/.*_\(.*\).csv.*/\1/')
sed -i "s/$/\t$sfx/" "$file"
done
Using sed:
$ sed 's/.*_\(.*\).csv.*/&\t\1/' file
DWH_Export_AUSTA_20120701_20120731_v1_1.csv.397.dat.2012-10-02 04-01-46.out 1
DWH_Export_AUSTA_20120701_20120731_v1_2.csv.397.dat.2012-10-02 04-03-12.out 2
DWH_Export_AUSTA_20120801_20120831_v1_1.csv.397.dat.2012-10-02 04-04-16.out 1
To make this for many files:
sed 's/.*_\(.*\).csv.*/&\t\1/' file1 file2 file3
OR
sed 's/.*_\(.*\).csv.*/&\t\1/' file*
To make this changed get saved in the same file(If you have GNU sed):
sed -i 's/.*\(.\).csv.*/&\t\1/' file
Untested, but this should do what you want (extract the number before .csv and append that number to the end of every line in the .out file)
awk 'FNR==1 { split(FILENAME, field, /[_.]/) }
{ print $0"\t"field[7] > FILENAME"_aaaa" }' *.out
for file in *_aaaa; do mv "$file" "${file/_aaaa}"; done
If I understood correctly, you want to append the number from the filename to every line in that file - this should do it:
#!/bin/bash
while [[ 0 < $# ]]; do
num=$(echo "$1" | sed -r 's/.*_([0-9]+).csv.*/\t\1/' )
#awk -e "{ print \$0\"\t${num}\"; }" < "$1" > "$1.new"
#sed -r "s/$/\t$num/" < "$1" > "$1.mew"
#sed -ri "s/$/\t$num/" "$1"
shift
done
Run the script and give it names of the files you want to process. $# is the number of command line arguments for the script which is decremented at the end of the loop by shift, which drops the first argument, and shifts the other ones. Extract the number from the filename and pick one of the three commented lines to do the appending: awk gives you more flexibility, first sed creates new files, second sed processes them in-place (in case you are running GNU sed, that is).
Instead of awk, you may want to go with sed or coreutils.
Grab number from filename, with grep for variety:
num=$(<<<filename grep -Eo '[^_]+\.csv' | cut -d. -f1)
<<<filename is equivalent to echo filename.
With sed
Append num to each line with GNU sed:
sed "s/\$/\t$num" filename
Use the -i switch to modify filename in-place.
With paste
You also need to know the length of the file for this method:
len=$(<filename wc -l)
Combine filename and num with paste:
paste filename <(seq $len | while read; do echo $num; done)
Complete example
for filename in DWH_Export*; do
num=$(echo $filename | grep -Eo '[^_]+\.csv' | cut -d. -f1)
sed -i "s/\$/\t$num" $filename
done