For example:
((
extract everything here, ignore the rest
))
I know how to ignore everything within, but I don't know how to do the opposite. Basically, it'll be a file and it needs to extract the data between the two points and then output it to another file. I've tried countless approaches, and all seem to tell me the indentation I'm stating doesn't exist in the file, when it does.
If somebody could point me in the right direction, I'd be grateful.
If your data are "line oriented", so the marker is alone (as in the example), you can try some of the following:
function getdata() {
cat - <<EOF
before
((
extract everything here, ignore the rest
someother text
))
after
EOF
}
echo "sed - with two seds"
getdata | sed -n '/((/,/))/p' | sed '1d;$d'
echo "Another sed solution"
getdata | sed -n '1,/((/d; /))/,$d;p'
echo "With GNU sed"
getdata | gsed -n '/((/{:a;n;/))/b;p;ba}'
echo "With perl"
getdata | perl -0777 -pe "s/.*\(\(\s*\\n(.*)?\)\).*/\$1/s"
Ps: yes, its looks like a dance of crazy toothpicks
Assuming you want to extract the string inside (( and )):
VAR="abc((def))ghi"
echo "$VAR"
VAR=${VAR##*((}
VAR=${VAR%%))*}
echo "$VAR"
## cuts away the longest string from the beginning; # cuts away the shortest string from the beginning; %% cuts away the longest string at the end; % cuts away the shortes string at the end
The file :
$ cat /tmp/l
((
extract everything here, ignore the rest
someother text
))
The script
$ awk '$1=="((" {p=1;next} $1=="))" {p=o;next} p' /tmp/l
extract everything here, ignore the rest
someother text
sed -n '/^((/,/^))/ { /^((/b; /^))/b; p }'
Brief explanation:
/^((/,/^))/: range addressing (inclusive)
{ /^((/b; /^))/b; p }: sequence of 3 commands
1. skip line with ^((
2. skip line with ^))
3. print
The line skipping is required to make the range selection exclusive.
Related
I'm a beginner in bash and here is my problem. I have a file just like this one:
Azzzezzzezzzezzz...
Bzzzezzzezzzezzz...
Czzzezzzezzzezzz...
I try in a script to edit this file.ABC letters are unique in all this file and there is only one per line.
I want to replace the first e of each line by a number who can be :
1 in line beginning with an A,
2 in line beginning with a B,
3 in line beginning with a C,
and I'd like to loop this in order to have this type of result
Azzz1zzz5zzz1zzz...
Bzzz2zzz4zzz5zzz...
Czzz3zzz6zzz3zzz...
All the numbers here are random int variables between 0 and 9. I really need to start by replacing 1,2,3 in first exec of my loop, then 5,4,6 then 1,5,3 and so on.
I tried this
sed "0,/e/s/e/$1/;0,/e/s/e/$2/;0,/e/s/e/$3/" /tmp/myfile
But the result was this (because I didn't specify the line)
Azzz1zzz2zzz3zzz...
Bzzzezzzezzzezzz...
Czzzezzzezzzezzz...
I noticed that doing sed -i "/A/ s/$/ezzz/" /tmp/myfile will add ezzz at the end of A line so I tried this
sed -i "/A/ 0,/e/s/e/$1/;/B/ 0,/e/s/e/$2/;/C/ 0,/e/s/e/$3/" /tmp/myfile
but it failed
sed: -e expression #1, char 5: unknown command: `0'
Here I'm lost.
I have in a variable (let's call it number_of_e_per_line) the number of e in either A, B or C line.
Thank you for the time you take for me.
Just apply s command on the line that matches A.
sed '
/^A/{ s/e/$1/; }
/^B/{ s/e/$2/; }
# or shorter
/^C/s/e/$3/
'
s command by default replaces the first occurrence. You can do for example s/s/$1/2 to replace the second occurrence, s/e/$1/g (like "Global") replaces all occurrences.
0,/e/ specifies a range of lines - it filters lines from the first up until a line that matches /e/.
sed is not part of Bash. It is a separate (crude) programming language and is a very standard command. See https://www.grymoire.com/Unix/Sed.html .
Continuing from the comment. sed is a poor choice here unless all your files can only have 3 lines. The reason is sed processes each line and has no way to keep a separate count for the occurrences of 'e'.
Instead, wrapping sed in a script and keeping track of the replacements allows you to handle any file no matter the number of lines. You just loop and handle the lines one at a time, e.g.
#!/bin/bash
[ -z "$1" ] && { ## valiate one argument for filename provided
printf "error: filename argument required.\nusage: %s filename\n" "./$1" >&2
exit 1
}
[ -s "$1" ] || { ## validate file exists and non-empty
printf "error: file not found or empty '%s'.\n" "$1"
exit 1
}
declare -i n=1 ## occurrence counter initialized 1
## loop reading each line
while read -r line || [ -n "$line" ]; do
[[ $line =~ ^.*e.*$ ]] || continue ## line has 'e' or get next
sed "s/e/1/$n" <<< "$line" ## substitute the 'n' occurence of 'e'
((n++)) ## increment counter
done < "$1"
Your data file having "..." at the end of each line suggests your files is larger than the snippet posted. If you have lines beginning 'A' - 'Z', you don't want to have to write 26 separate /match/s/find/replace/ substitutions. And if you have somewhere between 3 and 26 (or more), you don't want to have to rewrite a different sed expression for every new file you are faced with.
That's why I say sed is a poor choice. You really have no way to make the task a generic task with sed. The downside to using a script is it will become a poor choice as the number of records you need to process increase (over 100000 or so just due to efficiency)
Example Use/Output
With the script in replace-e-incremental.sh and your data in file, you would do:
$ bash replace-e-incremental.sh file
Azzz1zzzezzzezzz...
Bzzzezzz1zzzezzz...
Czzzezzzezzz1zzz...
To Modify file In-Place
Since you make multiple calls to sed here, you need to redirect the output of the file to a temporary file and then replace the original by overwriting it with the temp file, e.g.
$ bash replace-e-incremental.sh file > mytempfile && mv -f mytempfile file
$ cat file
Azzz1zzzezzzezzz...
Bzzzezzz1zzzezzz...
Czzzezzzezzz1zzz...
I have a .csv file that contains double quoted multi-line fields. I need to convert the multi-line cell to a single line. It doesn't show in the sample data but I do not know which fields might be multi-line so any solution will need to check every field. I do know how many columns I'll have. The first line will also need to be skipped. I don't how much data so performance isn't a consideration.
I need something that I can run from a bash script on Linux. Preferably using tools such as awk or sed and not actual programming languages.
The data will be processed further with Logstash but it doesn't handle double quoted multi-line fields hence the need to do some pre-processing.
I tried something like this and it kind of works on one row but fails on multiple rows.
sed -e :0 -e '/,.*,.*,.*,.*,/b' -e N -e '1n;N;N;N;s/\n/ /g' -e b0 file.csv
CSV example
First name,Last name,Address,ZIP
John,Doe,"Country
City
Street",12345
The output I want is
First name,Last name,Address,ZIP
John,Doe,Country City Street,12345
Jane,Doe,Country City Street,67890
etc.
etc.
First my apologies for getting here 7 months late...
I came across a problem similar to yours today, with multiple fields with multi-line types. I was glad to find your question but at least for my case I have the complexity that, as more than one field is conflicting, quotes might open, close and open again on the same line... anyway, reading a lot and combining answers from different posts I came up with something like this:
First I count the quotes in a line, to do that, I take out everything but quotes and then use wc:
quotes=`echo $line | tr -cd '"' | wc -c` # Counts the quotes
If you think of a single multi-line field, knowing if the quotes are 1 or 2 is enough. In a more generic scenario like mine I have to know if the number of quotes is odd or even to know if the line completes the record or expects more information.
To check for even or odd you can use the mod operand (%), in general:
even % 2 = 0
odd % 2 = 1
For the first line:
Odd means that the line expects more information on the next line.
Even means the line is complete.
For the subsequent lines, I have to know the status of the previous one. for instance in your sample text:
First name,Last name,Address,ZIP
John,Doe,"Country
City
Street",12345
You can say line 1 (John,Doe,"Country) has 1 quote (odd) what means the status of the record is incomplete or open.
When you go to line 2, there is no quote (even). Nevertheless this does not mean the record is complete, you have to consider the previous status... so for the lines following the first one it will be:
Odd means that record status toggles (incomplete to complete).
Even means that record status remains as the previous line.
What I did was looping line by line while carrying the status of the last line to the next one:
incomplete=0
cat file.csv | while read line; do
quotes=`echo $line | tr -cd '"' | wc -c` # Counts the quotes
incomplete=$((($quotes+$incomplete)%2)) # Check if Odd or Even to decide status
if [ $incomplete -eq 1 ]; then
echo -n "$line " >> new.csv # If line is incomplete join with next
else
echo "$line" >> new.csv # If line completes the record finish
fi
done
Once this was executed, a file in your format generates a new.csv like this:
First name,Last name,Address,ZIP
John,Doe,"Country City Street",12345
I like one-liners as much as everyone, I wrote that script just for the sake of clarity, you can - arguably - write it in one line like:
i=0;cat file.csv|while read l;do i=$((($(echo $l|tr -cd '"'|wc -c)+$i)%2));[[ $i = 1 ]] && echo -n "$l " || echo "$l";done >new.csv
I would appreciate it if you could go back to your example and see if this works for your case (which you most likely already solved). Hopefully this can still help someone else down the road...
Recovering the multi-line fields
Every need is different, in my case I wanted the records in one line to further process the csv to add some bash-extracted data, but I would like to keep the csv as it was. To accomplish that, instead of joining the lines with a space I used a code - likely unique - that I could then search and replace:
i=0;cat file.csv|while read l;do i=$((($(echo $l|tr -cd '"'|wc -c)+$i)%2));[[ $i = 1 ]] && echo -n "$l ~newline~ " || echo "$l";done >new.csv
the code is ~newline~, this is totally arbitrary of course.
Then, after doing my processing, I took the csv text file and replaced the coded newlines with real newlines:
sed -i 's/ ~newline~ /\n/g' new.csv
References:
Ternary operator: https://stackoverflow.com/a/3953666/6316852
Count char occurrences: https://stackoverflow.com/a/41119233/6316852
Other peculiar cases: https://www.linuxquestions.org/questions/programming-9/complex-bash-string-substitution-of-csv-file-with-multiline-data-937179/
TL;DR
Run this:
i=0;cat file.csv|while read l;do i=$((($(echo $l|tr -cd '"'|wc -c)+$i)%2));[[ $i = 1 ]] && echo -n "$l " || echo "$l";done >new.csv
... and collect results in new.csv
I hope it helps!
If Perl is your option, please try the following:
perl -e '
while (<>) {
$str .= $_;
}
while ($str =~ /("(("")|[^"])*")|((^|(?<=,))[^,]*((?=,)|$))/g) {
if (($el = $&) =~ /^".*"$/s) {
$el =~ s/^"//s; $el =~ s/"$//s;
$el =~ s/""/"/g;
$el =~ s/\s+(?!$)/ /g;
}
push(#ary, $el);
}
foreach (#ary) {
print /\n$/ ? "$_" : "$_,";
}' sample.csv
sample.csv:
First name,Last name,Address,ZIP
John,Doe,"Country
City
Street",12345
John,Doe,"Country
City
Street",67890
Result:
First name,Last name,Address,ZIP
John,Doe,Country City Street,12345
John,Doe,Country City Street,67890
This might work for you (GNU sed):
sed ':a;s/[^,]\+/&/4;tb;N;ba;:b;s/\n\+/ /g;s/"//g' file
Test each line to see that it contains the correct number of fields (in the example that was 4). If there are not enough fields, append the next line and repeat the test. Otherwise, replace the newline(s) by spaces and finally remove the "'s.
N.B. This may be fraught with problems such as ,'s between "'s and quoted "'s.
Try cat -v file.csv. When the file was made with Excel, you might have some luck: When the newlines in a field are a simple \n and the newline at the end is a \r\n (which will look like ^M), parsing is simple.
# delete all newlines and replace the ^M with a new newline.
tr -d "\n" < file.csv| tr "\r" "\n"
# Above two steps with one command
tr "\n\r" " \n" < file.csv
When you want a space between the joined line, you need an additional step.
tr "\n\r" " \n" < file.csv | sed '2,$ s/^ //'
EDIT: #sjaak commented this didn't work is his case.
When your broken lines also have ^M you still can be a lucky (wo-)man.
When your broken field is always the first field in double quotes and you have GNU sed 4.2.2, you can join 2 lines when the first line has exactly one double quote.
sed -rz ':a;s/(\n|^)([^"]*)"([^"]*)\n/\1\2"\3 /;ta' file.csv
Explanation:
-z don't use \n as line endings
:a label for repeating the step after successful replacement
(\n|^) Search after a newline or the very first line
([^"]*) Substring without a "
ta Go back to label a and repeat
awk pattern matching is working.
answer in one line :
awk '/,"/{ORS=" "};/",/{ORS="\n"}{print $0}' YourFile
if you'd like to drop quotes, you could use:
awk '/,"/{ORS=" "};/",/{ORS="\n"}{print $0}' YourFile | sed 's/"//gw NewFile'
but I prefer to keep it.
to explain the code:
/Pattern/ : find pattern in current line.
ORS : indicates the output line record.
$0 : indicates the whole of the current line.
's/OldPattern/NewPattern/': substitude first OldPattern with NewPattern
/g : does the previous action for all OldPattern
/w : write the result to Newfile
I am working with a fasta file and need to add line-specific text to each of the headers. So for example if my file is:
>TER1
AGCATGCTAGCTAGTCGACTCGATCGCATGCTC
>TER2
AGCATGCTAGCTAGACGACTCGATCGCATGCTC
>URC1
AGCATGCTAGCTAGTCGACTCGATCGCATGCTC
>URC2
AGCATGCTACCTAGTCGACTCGATCGCATGCTC
>UCR3
AGCATGCTAGCTAGTCGACTCGATGGCATGCTC
I want a while loop that will read through each line; for those with a > at the start, I want to append |population: plus the first three characters after the >. So line one would be:
>TER1|population:TER
etc.
I can't figure out how to make this work. Here my best attempt so far.
filename="testfasta.fa"
while read -r line
do
if [[ "$line" == ">"* ]]; then
id=$(cut -c2-4<<<"$line")
printf $line"|population:"$id"\n" >>outfile
else
printf $line"\n">>outfile
fi
done <"$filename"
This produces a file with the original headers and following line each on a single line.
Can someone tell me where I'm going wrong? My if and else loop aren't working at all!
Thanks!
You could use a while loop if you really want,
but sed would be simpler:
sed -e 's/^>\(...\).*/&|population:\1/' "$filename"
That is, for lines starting with > (pattern: ^>),
capture the next 3 characters (with \(...\)),
and match the rest of the line (.*),
replace with the line as it was (&),
and the fixed string |population:,
and finally the captured 3 characters (\1).
This will produce for your input:
>TER1|population:TER
AGCATGCTAGCTAGTCGACTCGATCGCATGCTC
>TER2|population:TER
AGCATGCTAGCTAGACGACTCGATCGCATGCTC
>URC1|population:URC
AGCATGCTAGCTAGTCGACTCGATCGCATGCTC
>URC2|population:URC
AGCATGCTACCTAGTCGACTCGATCGCATGCTC
>UCR3|population:UCR
AGCATGCTAGCTAGTCGACTCGATGGCATGCTC
Or you can use this awk, also producing the same output:
awk '{sub(/^>.*/, $0 "|population:" substr($0, 2, 3))}1' "$filename"
You can do this quickly in awk:
awk '$1~/^>/{$1=$1"|population:"substr($1,2,3)}{}1' infile.txt > outfile.txt
$ awk '$1~/^>/{$1=$1"|population:"substr($1,2,3)}{}1' testfile
>TER1|population:TER
AGCATGCTAGCTAGTCGACTCGATCGCATGCTC
>TER2|population:TER
AGCATGCTAGCTAGACGACTCGATCGCATGCTC
>URC1|population:URC
AGCATGCTAGCTAGTCGACTCGATCGCATGCTC
>URC2|population:URC
AGCATGCTACCTAGTCGACTCGATCGCATGCTC
>UCR3|population:UCR
AGCATGCTAGCTAGTCGACTCGATGGCATGCTC
Here awk will:
Test if the record starts with a > The $1 looks at the first field, but $0 for the entire record would work just as well in this case. The ~ will perform a regex test, and ^> means "Starts with >". Making the test: ($1~/^>/)
If so it will set the first field to the output you are looking for (using substr() to get the bits of the string you want. {$1=$1"|population:"substr($1,2,3)}
Finally it will print out the entire record (with the changes if applicable): {}1 which is shorthand for {print $0} or.. print the entire record.
I need to write bash script that converts a string of only integers "intString" to :id. intString always exists after /, may never contain any other types (create_step2 is not a valid intString), and may end at either a second / or end of line. intString may be any 1-8 characters. Script needs to be repeated for every line in a given file.
For example:
/sample/123456/url should be converted to /sample/:id/url
and /sample_url/9 should be converted to /sampleurl/:id however /sample_url_2/ should remain the same.
Any help would be appreciated!
It seems like the long way around the problem to go recursive but then I don't know what problem you are solving. It seems like a good sed command like
sed -E 's/\/[0-9]{1,}/\/:id/g'
could do it in one shot, but if you insist on being recursive then it might go something like this ...
#!/bin/bash
function restring()
{
s="$1"
s="$(echo $s | sed -E 's/\/[0-9]{1,}/\/:id/')"
if ( echo $s | grep -E '\/[0-9]{1,}' > /dev/null ) ; then
restring $s
else
echo $s
exit
fi
echo $s
}
restring "$1"
now run it
$ ./restring.sh "/foo/123/bar/456/baz/45435/andstuff"
/foo/:id/bar/:id/baz/:id/andstuff
**Edit: Okay, so I've tried implementing everyone's advice so far.
-I've added quotes around each variable "$1" and "$codon" to avoid whitespace.
-I've added the -ioc flag to grep to avoid caps.
-I tried using tr -d' ', however that leads to a runtime error because it says -d' ' is an invalid option.
Unfortunately I am still seeing the same problem. Or a different problem, which is that it tells me that every codon appears exactly once. Which is a different kind of wrong.
Thanks for everything so far - I'm still open to new ideas. I've updated my code below.**
I have this bash script that is supposed to count all permutations of (A C G T) in a given file.
One line of the script is not giving me the desired result and I don't know why - especially because I can enter the exact same line of code in the command prompt and get the desired result.
The line, executed in the command prompt, is:
cat dnafile | grep -o GCT | wc -l
This line tells me how many times the regular expression "GCT" appears in the file dnafile. When I run this command the result I get is 10 (which is accurate).
In the code itself, I run a modified version of the same command:
cat $1 | grep -o $codon | wc -l
Where $1 is the file name, and $codon is the 3-letter combination. When I run this from within the program, the answer I get is ALWAYS 0 (which is decidedly not accurate).
I was hoping one of you fine gents could enlighten this lost soul as to why this is not working as expected.
Thank you very, very much!
My code:
#!/bin/bash
#countcodons <dnafile> counts occurances of each codon in sequence contained within <dnafile>
if [[ $# != 1 ]]
then echo "Format is: countcodons <dnafile>"
exit
fi
nucleos=(a c g t)
allCods=()
#mix and match nucleotides to create all codons
for x in {0..3}
do
for y in {0..3}
do
for z in {0..3}
do
perm=${nucleos[$x]}${nucleos[$y]}${nucleos[$z]}
allCods=("${allCods[#]}" "$perm")
done
done
done
#for each codon, use grep to count # of occurances in file
len=${#allCods[*]}
for (( n=0; n<len; n++ ))
do
codon=${allCods[$n]}
occs=`cat "$1" | grep -ioc "$codon" | wc -l`
echo "$codon appears: $occs"
# if (( $occs > 0 ))
# then
# echo "$codon : $occs"
# fi
done
exit
You're generating your sequences in lowercase. Your code greps for gct, not GCT. You want to add the -i switch to grep. Try:
occs=`grep -ioc $codon $1`
You've got your logic backwards - you shouldn't have to read your input file once for every codon, you should only have to read it once and check each line for every codon.
You didn't supply any sample input or expected output so it's untested but something like this is the right approach:
awk '
BEGIN {
nucleosStr="a c g t"
split(nucleosStr,nucleos)
#mix and match nucleotides to create all codons
for (x in nucleos) {
for (y in nucleos) {
for (z in nucleos) {
perm = nucleos[x] nucleos[y] nucleos[z]
allCodsStr = allCodsStr (allCodsStr?" ":"") perm
}
}
}
split(allCodsStr,allCods)
}
{
#for each codon, count # of occurances in file
for (n in allCods) {
codon = allCods[n]
if ( tolower($0) ~ codon ) {
occs[n]++
}
}
}
END {
for (n in allCods) {
printf "%s appears: %d\n", allCods[n], occs[n]
}
}
' "$1"
I expect you'll see a huge performance improvement with that approach if your file is moderately large.
Try:
occs=`cat $1 | grep -o $codon | wc -l | tr -d ' '`
The problem is that wc indents the output, so $occs has a bunch of spaces at the beginning.