Append count after each match - bash
Sample input:
>Sample GJVT7LS03DEUKL
AAACTCCGCAATGCGCGCAAGC
>Sample GJVT7LS03CXJ53
AAACTCCGCAATGCGCGCAAGCGTGACGGGG
>Sample GJVT7LS03DJOYJ
AAACTCC
>Sample GJVT7LS03DMERH
AAACTCCGCAATGCGCGCAAGCGTGACGGGGGGAC
>Sample GJVT7LS03DN2RB
AAACTCCGCAATGCGCGCAAGCGTGACGG
What I want out:
>Sample_1 GJVT7LS03DEUKL
AAACTCCGCAATGCGCGCAAGC
>Sample_2 GJVT7LS03CXJ53
AAACTCCGCAATGCGCGCAAGCGTGACGGGG
>Sample_3 GJVT7LS03DJOYJ
AAACTCC
>Sample_4 GJVT7LS03DMERH
AAACTCCGCAATGCGCGCAAGCGTGACGGGGGGAC
>Sample_5 GJVT7LS03DN2RB
AAACTCCGCAATGCGCGCAAGCGTGACGG
In other words, I want to append count (preceded by "_") for each line that matches pattern ("Sample" in this case). Any sed/awk/etc. one-liners for this task?
One way:
$ awk '/^>/{$1=$1"_"++i}1' file
>Sample_1 GJVT7LS03DEUKL
AAACTCCGCAATGCGCGCAAGC
>Sample_2 GJVT7LS03CXJ53
AAACTCCGCAATGCGCGCAAGCGTGACGGGG
>Sample_3 GJVT7LS03DJOYJ
AAACTCC
>Sample_4 GJVT7LS03DMERH
AAACTCCGCAATGCGCGCAAGCGTGACGGGGGGAC
>Sample_5 GJVT7LS03DN2RB
AAACTCCGCAATGCGCGCAAGCGTGACGG
One possible attempt is as follows:
$ awk 'BEGIN{a=1}/Sample/ {$1=$1"_"a; a++}1' file
>Sample_1 GJVT7LS03DEUKL
AAACTCCGCAATGCGCGCAAGC
>Sample_2 GJVT7LS03CXJ53
AAACTCCGCAATGCGCGCAAGCGTGACGGGG
>Sample_3 GJVT7LS03DJOYJ
AAACTCC
>Sample_4 GJVT7LS03DMERH
AAACTCCGCAATGCGCGCAAGCGTGACGGGGGGAC
>Sample_5 GJVT7LS03DN2RB
AAACTCCGCAATGCGCGCAAGCGTGACGG
For each file containing "Sample" we update the first field with "_"$variable. This variable is a initially set to 1 and that we then increment in one.
Related
How to extract a string following a pattern using unix(mac OSX)
I have file with these columns and tab separated. Jun-AP1(bZIP)/K562-cJun-ChIP-Seq(GSE31477)/Homer 12.88% 4926.5 9.08% Maz(Zf)/HepG2-Maz-ChIP-Seq(GSE31477)/Homer 52.08% 25510.3 47.00% Bach2(bZIP)/OCILy7-Bach2-ChIP-Seq(GSE44420)/Homer 10.81% 4377 8.06% Atf3(bZIP)/GBM-ATF3-ChIP-Seq(GSE33912)/Homer 28.73% 13346.9 24.59% TEAD4(TEA)/Tropoblast-Tead4-ChIP-Seq(GSE37350)/Homer 40.43% 19549.3 36.01% In first column, I want to extract the string upto first bracket and keep rest of the columns same. For instance, I need the output as shown below. Jun-AP1 12.88% 4926.5 9.08% Maz 52.08% 25510.3 47.00% Bach2 10.81% 4377 8.06% Atf3 28.73% 13346.9 24.59% TEAD4 40.43% 19549.3 36.01% Thank you.
I would start with sed 's/([^ ]*//' where that's an actual tab character in [^ ].
awk '{sub(/\(.*Homer/,"")}{print $1,$2,$3,$4}' file Jun-AP1 12.88% 4926.5 9.08% Maz 52.08% 25510.3 47.00% Bach2 10.81% 4377 8.06% Atf3 28.73% 13346.9 24.59% TEAD4 40.43% 19549.3 36.01%
Parsing CSV file with \n in double quoted fields
I'm parsing a CSV file that has a break line in double quoted fields. I'm reading the file line by line with a groovy script but I get an ArrayIndexOutBoundException when I tried to get access the missing tokens. I was trying to pre-process the file to remove those characters and I was thinking to do that with some bash script or with groovy itself. Could you, please suggest any approach that I can use to resolve the problem? This is how the CSV looks like: header1,header2,header3,header4 timestamp, "abcdefghi", "abcdefghi","sdsd" timestamp, "zxcvb fffffgfg","asdasdasadsd","sdsdsd" This is the groovy script I'm using def csv = new File(args[0]).text def bufferString = "" def parsedFile = new File("Parsed_" + args[0]); csv.eachLine { line, lineNumber -> def splittedLine = line.split(','); retString += new Date(splittedLine[0]) + ",${splittedLine[1]},${splittedLine[2]},${splittedLine[3]}\n"; if(lineNumber % 1000 == 0){ parsedFile.append(retString); retString = ""; } } parsedFile.append(retString); UPDATE: Finally I did this and it works, (I needed format the first column from timestamp to a human readable date): gawk -F',' '{print strftime("%Y-%m-%d %H:%M:%S", substr( $1, 0, length($1)-3 ) )","($2)","($3)","($4)}' TobeParsed.csv > Parsed.csv Thank you #karakfa
If you use a proper CSV parser rather than trying to do it with split (which as you can see doesn't work with any form of quoting), then it works fine: #Grab('com.xlson.groovycsv:groovycsv:1.1') import static com.xlson.groovycsv.CsvParser.parseCsv def csv = '''header1,header2,header3,header4 timestamp, "abcdefghi", "abcdefghi","sdsd" timestamp, "zxcvb fffffgfg","asdasdasadsd","sdsdsd"''' def data = parseCsv(csv) data.eachWithIndex { line, index -> println """Line $index: | 1:$line.header1 | 2:$line.header2 | 3:$line.header3 | 4:$line.header4""".stripMargin() } Which prints: Line 0: 1:timestamp 2:abcdefghi 3:abcdefghi 4:sdsd Line 1: 1:timestamp 2:zxcvb fffffgfg 3:asdasdasadsd 4:sdsdsd
awk to the rescue! this will merge the newline split fields together, you process can take it from there $ awk -F'"' '!(NF%2){getline remainder;$0=$0 OFS remainder}1' splitted.csv header1,header2,header3 xxxxxx, "abcdefghi", "abcdefghi" yyyyyy, "zxcvb fffffgfg","asdasdasadsd" assumes that odd number of quotes mean split field and replace new line with OFS. If you want to simple delete new line (the split parts will combine) remove OFS.
error in writing to a file
I have written a python script that calls unix sort using subprocess module. I am trying to sort a table based on two columns(2 and 6). Here is what I have done sort_bt=open("sort_blast.txt",'w+') sort_file_cmd="sort -k2,2 -k6,6n {0}".format(tab.name) subprocess.call(sort_file_cmd,stdout=sort_bt,shell=True) The output file however contains an incomplete line which produces an error when I parse the table but when I checked the entry in the input file given to sort the line looks perfect. I guess there is some problem when sort tries to write the result to the file specified but I am not sure how to solve it though. The line looks like this in the input file gi|191252805|ref|NM_001128633.1| Homo sapiens RIMS binding protein 3C (RIMBP3C), mRNA gnl|BL_ORD_ID|4614 gi|124487059|ref|NP_001074857.1| RIMS-binding protein 2 [Mus musculus] 103 2877 3176 846 941 1.0102e-07 138.0 In output file however only gi|19125 is printed. How do I solve this? Any help will be appreciated. Ram
Using subprocess to call an external sorting tool seems quite silly considering that python has a built in method for sorting items. Looking at your sample data, it appears to be structured data, with a | delimiter. Here's how you could open that file, and iterate over the results in python in a sorted manner: def custom_sorter(first, second): """ A Custom Sort function which compares items based on the value in the 2nd and 6th columns. """ # First, we break the line into a list first_items, second_items = first.split(u'|'), second.split(u'|') # Split on the pipe character. if len(first_items) >= 6 and len(second_items) >= 6: # We have enough items to compare if (first_items[1], first_items[5]) > (second_items[1], second_items[5]): return 1 elif (first_items[1], first_items[5]) < (second_items[1], second_items[5]): return -1 else: # They are the same return 0 # Order doesn't matter then else: return 0 with open(src_file_path, 'r') as src_file: data = src_file.read() # Read in the src file all at once. Hope the file isn't too big! with open(dst_sorted_file_path, 'w+') as dst_sorted_file: for line in sorted(data.splitlines(), cmp = custom_sorter): # Sort the data on the fly dst_sorted_file.write(line) # Write the line to the dst_file. FYI, this code may need some jiggling. I didn't test it too well.
What you see is probably the result of trying to write to the file from multiple processes simultaneously. To emulate: sort -k2,2 -k6,6n ${tabname} > sort_blast.txt command in Python: from subprocess import check_call with open("sort_blast.txt",'wb') as output_file: check_call("sort -k2,2 -k6,6n".split() + [tab.name], stdout=output_file) You can write it in pure Python e.g., for a small input file: def custom_key(line): fields = line.split() # split line on any whitespace return fields[1], float(fields[5]) # Python uses zero-based indexing with open(tab.name) as input_file, open("sort_blast.txt", 'w') as output_file: L = input_file.read().splitlines() # read from the input file L.sort(key=custom_key) # sort it output_file.write("\n".join(L)) # write to the output file If you need to sort a file that does not fit in memory; see Sorting text file by using Python
alphanumeric sort in VIM
Suppose I have a list in a text file which is as follows - TaskB_115 TaskB_19 TaskB_105 TaskB_13 TaskB_10 TaskB_0_A_1 TaskB_17 TaskB_114 TaskB_110 TaskB_0_A_5 TaskB_16 TaskB_12 TaskB_113 TaskB_15 TaskB_103 TaskB_2 TaskB_18 TaskB_106 TaskB_11 TaskB_14 TaskB_104 TaskB_112 TaskB_107 TaskB_0_A_4 TaskB_102 TaskB_100 TaskB_109 TaskB_101 TaskB_0_A_2 TaskB_0_A_3 TaskB_116 TaskB_1_A_0 TaskB_111 TaskB_108 If I sort in vim with command %sort, it gives me output as - TaskB_0_A_1 TaskB_0_A_2 TaskB_0_A_3 TaskB_0_A_4 TaskB_0_A_5 TaskB_10 TaskB_100 TaskB_101 TaskB_102 TaskB_103 TaskB_104 TaskB_105 TaskB_106 TaskB_107 TaskB_108 TaskB_109 TaskB_11 TaskB_110 TaskB_111 TaskB_112 TaskB_113 TaskB_114 TaskB_115 TaskB_116 TaskB_12 TaskB_13 TaskB_14 TaskB_15 TaskB_16 TaskB_17 TaskB_18 TaskB_19 TaskB_1_A_0 TaskB_2 But I would like to have the output as follows - TaskB_0_A_1 TaskB_0_A_2 TaskB_0_A_3 TaskB_0_A_4 TaskB_0_A_5 TaskB_1_A_0 TaskB_2 TaskB_10 TaskB_11 TaskB_12 TaskB_13 TaskB_14 TaskB_15 TaskB_16 TaskB_17 TaskB_18 TaskB_19 TaskB_100 TaskB_101 TaskB_102 TaskB_103 TaskB_104 TaskB_105 TaskB_106 TaskB_107 TaskB_108 TaskB_109 TaskB_110 TaskB_111 TaskB_112 TaskB_113 TaskB_114 TaskB_115 TaskB_116 Note I just wrote this list to demonstrate the problem. I could generate the list in VIM. But I want to do it for other things as well in VIM.
With [n] sorting is done on the first decimal number in the line (after or inside a {pattern} match). One leading '-' is included in the number. try this command: sor n and you don't need the %, sort sorts all lines if no range was given. EDIT as commented by OP, if you have: TaskB_0_A_1 TaskB_0_A_2 TaskB_0_A_4 TaskB_0_A_3 TaskB_0_A_5 TaskB_1_A_0 you could try: sor n /.*_\ze\d*/ or sor nr /\d*$/ EDIT2 for newly edited question, this line may give you expected output based on your example data: sor nr /\d*$/|sor n
how to replace last comma in a line with a string in unix
I trying to insert a string in every line except for first and last lines in a file, but not able to get it done, can anyone give some clue how to achieve? Thanks in advance. How to replace last comma in a line with a string xxxxx (except for first and last rows) using unix Original File 00,SRI,BOM,FF,000004,20120808030100,20120907094412,"GTEXPR","SRIVIM","8894-7577","SRIVIM#GTEXPR." 10,SRI,FF,NMNN,3112,NMNSME,U,NM,GEB,,230900,02BLYPO 10,SRI,FF,NMNN,3112,NMNSME,U,NM,TCM,231040,231100,01 10,SRI,FF,NMNN,3112,NMNSME,U,NM,UPW,231240,231300,01 10,SRI,FF,NMNN,3112,NMNSME,U,NM,UFG,231700,231900,01 10,SRI,FF,NMNN,3112,NMNSME,U,NM,FTG,232140,232200,01 10,SRI,FF,NMNN,3112,NMNSME,U,NM,BOR,232340,232400,01 10,SRI,FF,NMNN,3112,NMNSME,U,NM,BAY,232640,232700,01 10,SRI,FF,NMNN,3112,NMNSME,U,NM,RWD,233400,,01 10,SRI,FF,BUN,0800,NMJWJB,U,NM,CCL,,101400,02CHLSU 10,SRI,FF,BUN,0800,NMJWJB,U,NM,PAR,101540,101700,01 10,SRI,FF,BUN,0800,NMJWJB,U,NM,MCE,101840,101900,01 10,SRI,FF,BUN,0800,NMJWJB,U,NM,SSS,102140,102200,09 10,SRI,FF,BUN,0800,NMJWJB,U,NM,FSS,102600,,01 10,SRI,FF,BUN,0802,NMJWJB,U,NM,CCL,,103700,01CHLSU 10,SRI,FF,BUN,0802,NMJWJB,U,NM,PAR,103940,104000,01 10,SRI,FF,BUN,0802,NMJWJB,U,NM,MCE,104140,104200,01 10,SRI,FF,BUN,0802,NMJWJB,U,NM,SSS,104440,104500,09 10,SRI,FF,BUN,0802,NMJWJB,U,NM,FSS,105000,,01 10,SRI,FF,BUN,3112,NMNSME,U,NM,GEB,,230900,02BLYSU 10,SRI,FF,BUN,3112,NMNSME,U,NM,TCM,231040,231100,01 10,SRI,FF,BUN,3112,NMNSME,U,NM,UPW,231240,231300,01 10,SRI,FF,BUN,3112,NMNSME,U,NM,UFG,231700,231900,01 10,SRI,FF,BUN,3112,NMNSME,U,NM,FTG,232140,232200,01 10,SRI,FF,BUN,3112,NMNSME,U,NM,BOR,232340,232400,01 10,SRI,FF,BUN,3112,NMNSME,U,NM,BAY,232640,232700,01 10,SRI,FF,BUN,3112,NMNSME,U,NM,RWD,233400,,01 99,SRI,FF,28 Expected File 00,SRI,BOM,FF,000004,20120808030100,20120907094412,"GTEXPR","SRIVIM","8894-7577","SRIVIM#GTEXPR." 10,SRI,FF,NMNN,3112,NMNSME,U,NM,GEB,,230900,xxxxx02BLYPO 10,SRI,FF,NMNN,3112,NMNSME,U,NM,TCM,231040,xxxxx231100,01 10,SRI,FF,NMNN,3112,NMNSME,U,NM,UPW,231240,xxxxx231300,01 10,SRI,FF,NMNN,3112,NMNSME,U,NM,UFG,231700,xxxxx231900,01 10,SRI,FF,NMNN,3112,NMNSME,U,NM,FTG,232140,xxxxx232200,01 10,SRI,FF,NMNN,3112,NMNSME,U,NM,BOR,232340,xxxxx232400,01 10,SRI,FF,NMNN,3112,NMNSME,U,NM,BAY,232640,xxxxx232700,01 10,SRI,FF,NMNN,3112,NMNSME,U,NM,RWD,233400,,xxxxx01 10,SRI,FF,BUN,0800,NMJWJB,U,NM,CCL,,101400,xxxxx02CHLSU 10,SRI,FF,BUN,0800,NMJWJB,U,NM,PAR,101540,101700,xxxxx01 10,SRI,FF,BUN,0800,NMJWJB,U,NM,MCE,101840,101900,xxxxx01 10,SRI,FF,BUN,0800,NMJWJB,U,NM,SSS,102140,102200,xxxxx09 10,SRI,FF,BUN,0800,NMJWJB,U,NM,FSS,102600,,xxxxx01 10,SRI,FF,BUN,0802,NMJWJB,U,NM,CCL,,103700,xxxxx01CHLSU 10,SRI,FF,BUN,0802,NMJWJB,U,NM,PAR,103940,104000,xxxxx01 10,SRI,FF,BUN,0802,NMJWJB,U,NM,MCE,104140,104200,xxxxx01 10,SRI,FF,BUN,0802,NMJWJB,U,NM,SSS,104440,104500,xxxxx09 10,SRI,FF,BUN,0802,NMJWJB,U,NM,FSS,105000,,xxxxx01 10,SRI,FF,BUN,3112,NMNSME,U,NM,GEB,,230900,xxxxx02BLYSU 10,SRI,FF,BUN,3112,NMNSME,U,NM,TCM,231040,231100,xxxxx01 10,SRI,FF,BUN,3112,NMNSME,U,NM,UPW,231240,231300,xxxxx01 10,SRI,FF,BUN,3112,NMNSME,U,NM,UFG,231700,231900,xxxxx01 10,SRI,FF,BUN,3112,NMNSME,U,NM,FTG,232140,232200,xxxxx01 10,SRI,FF,BUN,3112,NMNSME,U,NM,BOR,232340,232400,xxxxx01 10,SRI,FF,BUN,3112,NMNSME,U,NM,BAY,232640,232700,xxxxx01 10,SRI,FF,BUN,3112,NMNSME,U,NM,RWD,233400,,xxxxx01 99,SRI,FF,28
awk can be quite useful for manipulating data files like this one. Here's a one-liner that does more-or-less what you want. It prepends the string "xxxxx" to the twelfth field of each input line that has at least twelve fields. $ awk 'BEGIN{FS=OFS=","}NF>11{$12="xxxxx"$12}{print}' 16006747.txt 00,SRI,BOM,FF,000004,20120808030100,20120907094412,"GTEXPR","SRIVIM","8894-7577","SRIVIM#GTEXPR." 10,SRI,FF,NMNN,3112,NMNSME,U,NM,GEB,,230900,xxxxx02BLYPO 10,SRI,FF,NMNN,3112,NMNSME,U,NM,TCM,231040,231100,xxxxx01 10,SRI,FF,NMNN,3112,NMNSME,U,NM,UPW,231240,231300,xxxxx01 10,SRI,FF,NMNN,3112,NMNSME,U,NM,UFG,231700,231900,xxxxx01 10,SRI,FF,NMNN,3112,NMNSME,U,NM,FTG,232140,232200,xxxxx01 10,SRI,FF,NMNN,3112,NMNSME,U,NM,BOR,232340,232400,xxxxx01 10,SRI,FF,NMNN,3112,NMNSME,U,NM,BAY,232640,232700,xxxxx01 10,SRI,FF,NMNN,3112,NMNSME,U,NM,RWD,233400,,xxxxx01 10,SRI,FF,BUN,0800,NMJWJB,U,NM,CCL,,101400,xxxxx02CHLSU 10,SRI,FF,BUN,0800,NMJWJB,U,NM,PAR,101540,101700,xxxxx01 10,SRI,FF,BUN,0800,NMJWJB,U,NM,MCE,101840,101900,xxxxx01 10,SRI,FF,BUN,0800,NMJWJB,U,NM,SSS,102140,102200,xxxxx09 10,SRI,FF,BUN,0800,NMJWJB,U,NM,FSS,102600,,xxxxx01 10,SRI,FF,BUN,0802,NMJWJB,U,NM,CCL,,103700,xxxxx01CHLSU 10,SRI,FF,BUN,0802,NMJWJB,U,NM,PAR,103940,104000,xxxxx01 10,SRI,FF,BUN,0802,NMJWJB,U,NM,MCE,104140,104200,xxxxx01 10,SRI,FF,BUN,0802,NMJWJB,U,NM,SSS,104440,104500,xxxxx09 10,SRI,FF,BUN,0802,NMJWJB,U,NM,FSS,105000,,xxxxx01 10,SRI,FF,BUN,3112,NMNSME,U,NM,GEB,,230900,xxxxx02BLYSU 10,SRI,FF,BUN,3112,NMNSME,U,NM,TCM,231040,231100,xxxxx01 10,SRI,FF,BUN,3112,NMNSME,U,NM,UPW,231240,231300,xxxxx01 10,SRI,FF,BUN,3112,NMNSME,U,NM,UFG,231700,231900,xxxxx01 10,SRI,FF,BUN,3112,NMNSME,U,NM,FTG,232140,232200,xxxxx01 10,SRI,FF,BUN,3112,NMNSME,U,NM,BOR,232340,232400,xxxxx01 10,SRI,FF,BUN,3112,NMNSME,U,NM,BAY,232640,232700,xxxxx01 10,SRI,FF,BUN,3112,NMNSME,U,NM,RWD,233400,,xxxxx01 99,SRI,FF,28