I want to replace a Hadoop job with Hive. My challenge is in Hadoop, I'm using setup() to build a kdtree by reading in reference data (points of interest) from the distributed cache. I then use the kdtree in map() to evaluate distance of the target data against the kdtree.
In Hive, I wanted to use a udf with evaluate() method to determine the distance, but I don't know how to setup the kdtree with the reference data. Is this possible?
I probably don't have the entire answer, so I'm just going to throw out some ideas that might be of help.
You can add files to the distributed cache in hive using ADD FILE ...
Hive 11+ (I think) should let you access to the distributed cache in GenericUDF.initialize
https://issues.apache.org/jira/browse/HIVE-1016 which references...
https://issues.apache.org/jira/browse/HIVE-3628
So when you initialize the UDF, you might be able to build your kdtree by accessing the file you added in the distributed cache.
Like climbage says ADD FILE command adds the file into distributed cache.
You can access the distributed cache in your UDF simply by opening a file which is in the current directory.
ie... open( new File( System.getProperty("user.dir") + "/myfile") );
You can use a ConstantObjectInspector to access the filename in the initialize method of GenericUDF, where you can open the file and read into memory into your data structure.
The distributed_map UDF of Brickhouse does something similar ( https://github.com/klout/brickhouse/blob/master/src/main/java/brickhouse/udf/dcache/DistributedMapUDF.java )
Something like
public ObjectInspector initialize(ObjectInspector[] inspArr) {
ConstantObjectInspector fileNameInsp = (ConstantObjectInspector)inspArr[0];
String fileName = fileNameInsp.getWritableConstantValue().toString();
FileInputStream inFile = new FileInputStream("./" + fileName);
doStuff( inFile );
.....
}
Related
i am trying to read the sequence file generated by hive using spark. When i try to access the file , i am facing org.apache.spark.SparkException: Job aborted due to stage failure: Task not serializable: java.io.NotSerializableException:
I have tried the workarounds for this issue like making the class serializable, still i face the issue. I am writing the code snippet here , please let me know what i am missing here.
Is it because of the BytesWritable data type or something else which is causing the issue.
JavaPairRDD<BytesWritable, Text> fileRDD = javaCtx.sequenceFile("hdfs://path_to_the_file", BytesWritable.class, Text.class);
List<String> result = fileRDD.map(new Function<Tuple2<BytesWritables,Text>,String>(){
public String call (Tuple2<BytesWritable,Text> row){
return row._2.toString()+"\n";
}).collect();
}
Here is what was needed to make it work
Because we use HBase to store our data and this reducer outputs its result to HBase table, Hadoop is telling us that he doesn’t know how to serialize our data. That is why we need to help it. Inside setUp set the io.serializations variable
You can do it in spark accordingly
conf.setStrings("io.serializations", new String[]{hbaseConf.get("io.serializations"), MutationSerialization.class.getName(), ResultSerialization.class.getName()});
I'm working on a tool for converting data from a homegrown format to Parquet and JSON (for use in different settings with Spark, Drill and MongoDB), using Avro with Specific Mapping as the stepping stone. I have to support conversion of new data on a regular basis and on client machines which is why I try to write my own standalone conversion tool with a (Avro|Parquet|JSON) switch instead of using Drill or Spark or other tools as converters as I probably would if this was a one time job. I'm basing the whole thing on Avro because this seems like the easiest way to get conversion to Parquet and JSON under one hood.
I used Specific Mapping to profit from static type checking, wrote an IDL, converted that to a schema.avsc, generated classes and set up a sample conversion with specific constructor, but now I'm stuck configuring the writers. All Avro-Parquet conversion examples I could find [0] use AvroParquetWriter with deprecated signatures (mostly: Path file, Schema schema) and Generic Mapping.
AvroParquetWriter has only one none-deprecated Constructor, with this signature:
AvroParquetWriter(
Path file,
WriteSupport<T> writeSupport,
CompressionCodecName compressionCodecName,
int blockSize,
int pageSize,
boolean enableDictionary,
boolean enableValidation,
WriterVersion writerVersion,
Configuration conf
)
Most of the parameters are not hard to figure out but WriteSupport<T> writeSupport throws me off. I can't find any further documentation or an example.
Staring at the source of AvroParquetWriter I see GenericData model pop up a few times but only one line mentioning SpecificData: GenericData model = SpecificData.get();.
So I have a few questions:
1) Does AvroParquetWriter not support Avro Specific Mapping? Or does it by means of that SpecificData.get() method? The comment "Utilities for generated Java classes and interfaces." over 'SpecificData.class` seems to suggest that but how exactly should I proceed?
2) What's going on in the AvroParquetWriter constructor, is there an example or some documentation to be found somewhere?
3) More specifically: the signature of the WriteSupport method asks for 'Schema avroSchema' and 'GenericData model'. What does GenericData model refer to? Maybe I'm not seeing the forest because of all the trees here...
To give an example of what I'm aiming for, my central piece of Avro conversion code currently looks like this:
DatumWriter<MyData> avroDatumWriter = new SpecificDatumWriter<>(MyData.class);
DataFileWriter<MyData> dataFileWriter = new DataFileWriter<>(avroDatumWriter);
dataFileWriter.create(schema, avroOutput);
The Parquet equivalent currently looks like this:
AvroParquetWriter<SpecificRecord> parquetWriter = new AvroParquetWriter<>(parquetOutput, schema);
but this is not more than a beginning and is modeled after the examples I found, using the deprecated constructor, so will have to change anyway.
Thanks,
Thomas
[0] Hadoop - The definitive Guide, O'Reilly, https://gist.github.com/hammer/76996fb8426a0ada233e, http://www.programcreek.com/java-api-example/index.php?api=parquet.avro.AvroParquetWriter
Try AvroParquetWriter.builder :
MyData obj = ... // should be avro Object
ParquetWriter<Object> pw = AvroParquetWriter.builder(file)
.withSchema(obj.getSchema())
.build();
pw.write(obj);
pw.close();
Thanks.
I am using MRUnit to write unit tests for my mapreduce jobs.
However, I am having trouble including hdfs into that mix. My MR job needs a file from hdfs. How do I mock out the hdfs part in MRUnit test case?
Edit:
I know that I can specify inputs/exepctedOutput for my MR code in the test infrastructure. However, that is not what I want. My MR job needs to read another file that has domain data to do the job. This file is in HDFS. How do I mock out this file?
I tried using mockito but it didnt work. The reason was that FileSystem.open() returns a FSDataInputStream which inherits from other interfaces besides java.io.Stream. It was too painful to mock out all the interfaces. So, I hacked it in my code by doing the following
if (System.getProperty("junit_running") != null)
{
inputStream = this.getClass().getClassLoader().getResourceAsStream("domain_data.txt");
br = new BufferedReader(new InputStreamReader(inputStream));
} else {
Path pathToRegionData = new Path("/domain_data.txt");
LOG.info("checking for existence of region assignment file at path: " + pathToRegionData.toString());
if (!fileSystem.exists(pathToRegionData))
{
LOG.error("domain file does not exist at path: " + pathToRegionData.toString());
throw new IllegalArgumentException("region assignments file does not exist at path: " + pathToRegionData.toString());
}
inputStream = fileSystem.open(pathToRegionData);
br = new BufferedReader(new InputStreamReader(inputStream));
}
This solution is not ideal because I had to put test specific code in my production code. I am still waiting to see if there is an elegant solution out there.
Please follow the this small tutorial for MRUnit.
https://github.com/malli3131/HadoopTutorial/blob/master/MRUnit/Tutorial
In MRUnit test case, we supply the data inside the testMapper() and testReducer() methods. So there is no need of input from HDFS for MRUnit Job. Only MapReduce jobs require data inputs from HDFS.
I am new to hadoop. Basically I am writing a program which takes two multifasta files (ref.fasta,query.fasta) which are 3+ GB.....
ref.fasta:
gi|12345
ATATTATAGGACACCAATAAAATT..
gi|5253623
AATTATCGCAGCATTA...
..and so on..
query.fasta:
query
ATTATTTAAATCTCACACCACATAATCAATACA
AATCCCCACCACAGCACACGTGATATATATACA
CAGACACA...
NOw to each mapper I need to give a single part of ref file and the whole query file.
i.e
gi|12345
ATATTATAGGACACCAATA....
(a single fasta sequence from ref file)
AND the entire query file.because I want to run an exe inside mapper which takes these both as input.
so do i process ref.fasta outside and then give it to mapper?or some thing else..??
I just need approach which will take minimum time.
Thanks.
The best approach for your use-case may be to have the query file in distributed cache and get the file object ready in the configure()/setup() to be used in the map(). And have the ref file as normal input.
You may do the following:
In your run() add the query file to the distributed cache:
DistributedCache.addCacheFile(new URI(queryFile-HDFS-Or-S3-Path), conf);
Now have the mapper class something like following:
public static class MapJob extends MapReduceBase implements Mapper {
File queryFile;
#Override
public void configure(JobConf job) {
Path queryFilePath = DistributedCache.getLocalCacheFiles(job)[0];
queryFile = new File(queryFilePath.toString());
}
#Override
public void map(LongWritable key, Text value, OutputCollector<Text, Text> output, Reporter reporter)
throws IOException {
// Use the queryFile object and [key,value] from your ref file here to run the exe file as desired.
}
}
I faced a similar problem.
I'd suggest you pre-process your ref file and split it into multiple files (one per sequence).
Then copy those files to a folder on the hdfs that you will set as your input path in your main method.
Then implement a custom input format class and custom record reader class. Your record reader will just pass the name of the local file split path (as a Text value) to either the key or value parameter of your map method.
For the query file that is require by all map functions, again add your query file to the hdfs and then add it to the DistributedCache in your main method.
In your map method you'll then have access to both local file paths and can pass them to your exe.
Hope that helps.
I had a similar problem and eventually re-implemented the functionality of blast exe file so that I didn't need to deal with reading files in my map method and could instead deal entire with Java objects (Genes and Genomes) that are parsed from the input files by my custom record reader and then passed as objects to my map function.
Cheers, Wayne.
For a project of mine, I want to analyse around 2 TB of Protobuf objects. I want to consume these objects in a Pig Script via the "elephant bird" library. However it is not totally clear to my how to write a file to HDFS so that it can be consumed by the ProtobufPigLoader class.
This is what I have:
Pig script:
register ../fs-c/lib/*.jar // this includes the elephant bird library
register ../fs-c/*.jar
raw_data = load 'hdfs://XXX/fsc-data2/XXX*' using com.twitter.elephantbird.pig.load.ProtobufPigLoader('de.pc2.dedup.fschunk.pig.PigProtocol.File');
Import tool (parts of it):
def getWriter(filenamePath: Path) : ProtobufBlockWriter[de.pc2.dedup.fschunk.pig.PigProtocol.File] = {
val conf = new Configuration()
val fs = FileSystem.get(filenamePath.toUri(), conf)
val os = fs.create(filenamePath, true)
val writer = new ProtobufBlockWriter[de.pc2.dedup.fschunk.pig.PigProtocol.File](os, classOf[de.pc2.dedup.fschunk.pig.PigProtocol.File])
return writer
}
val writer = getWriter(new Path(filename))
val builder = de.pc2.dedup.fschunk.pig.PigProtocol.File.newBuilder()
writer.write(builder.build)
writer.finish()
writer.close()
The import tool runs fine. I had a few problems with the ProtobufPigLoader because I cannot use the hadoop-lzo compression library, and without a fix (see here) ProtobufPigLoader isn't working. The problem where I have problems is that DUMP raw_data; returns Unable to open iterator for alias raw_data and ILLUSTRATE raw_data; returns No (valid) input data found!.
For me, it looks like the ProtobufBlockWriter data cannot be read by the ProtobufPigLoader. But what to use instead? How to write data in a external tool to HDFS so that it can be processed by ProtobufPigLoader.
Alternative question: What to use instead? How to write pretty large objects to Hadoop to consume it with Pig? The objects are not very complex, but contain a large list of sub-objects in a list (repeated field in Protobuf).
I want to avoid any text format or JSON because they are simply to large for my data. I expect that it would bloat up the data by a factor of 2 or 3 (lots of integer, lots of byte strings that I would need to encode as Base64)..
I want to avoid normalizing the data so that the id of the main object is attached to each of the subobjects (this is what is done now) because this also blows up the space consumption and makes joins necessary in the later processing.
Updates:
I didn't use the generation of protobuf loader classes, but use the reflection type loader
The protobuf classes are in a jar that is registered. DESCRIBE correctly shows the types.