Related
Let's suppose that you need to generate a NUL-delimited stream of timestamped filenames.
On Linux & Solaris I can do it with:
stat --printf '%.9Y %n\0' -- *
On BSD, I can get the same info, but delimited by newlines, with:
stat -f '%.9Fm %N' -- *
The man talks about a few escape sequences but the NUL byte doesn't seem supported:
If the % is immediately followed by one of n, t, %, or #, then a newline character, a tab character, a percent character, or the current file number is printed.
Is there a way to work around that? edit: (accurately and efficiently?)
Update:
Sorry, the glob * is misleading. The arguments can contain any path.
I have a working solution that forks a stat call for each path. I want to improve it because of the massive number of files to process.
You may try this work-around solution if running stat command for files:
stat -nf "%.9Fm %N/" * | tr / '\0'
Here:
-n: To suppress newlines in stat output
Added / as terminator for each entry from stat output
tr / '\0': To convert / into NUL byte
Another work-around is to use a control character in stat and use tr to replace it with \0 like this:
stat -nf "%.9Fm %N"$'\1' * | tr '\1' '\0'
This will work with directories also.
Unfortunately, stat out of the box does not offer this option, and so what you ask is not directly achievable.
However, you can easily implement the required functionality in a scripting language like Perl or Python.
#!/usr/bin/env python3
from pathlib import Path
from sys import argv
for arg in argv[1:]:
print(
Path(arg).stat().st_mtime,
arg, end="\0")
Demo: https://ideone.com/vXiSPY
The demo exhibits a small discrepancy in the mtime which does not seem to be a rounding error, but the result could be different on MacOS (the demo platform is Debian Linux, apparently). If you want to force the result to a particular number of decimal places, Python has formatting facilities similar to those of stat and printf.
With any command that can't produce NUL-terminated (or any other character/string terminated) output, you can just wrap it in a function to call the command and then printf it's output with a terminating NUL instead of newline, for example:
nulstat() {
local fmt=$1 file
shift
for file in "$#"; do
printf '%s\0' "$(stat -f "$fmt" "$file")"
done
}
nulstat '%.9Fm %N' *
For example:
$ > foo
$ > $'foo\nbar'
$ nulstat '%.9Fm %N' foo* | od -c
0000000 1 6 6 3 1 6 2 5 3 6 . 4 7 7 9 8
0000020 0 1 4 0 f o o \0 1 6 6 3 1 6 2
0000040 5 3 9 . 3 8 8 0 6 9 9 3 0 f o
0000060 o \n b a r \0
0000066
1. What you can do (accurate but slow):
Fork a stat command for each input path:
for p in "$#"
do
stat -nf '%.9Fm' -- "$p" &&
printf '\t%s\0' "$p"
done
2. What you can do (accurate but twisted):
In the input paths, replace each occurrence of (possibly overlapping) /././ with a single /./, make stat output /././\n at the end of each record, and use awk to substitute each /././\n by a NUL byte:
#!/bin/bash
shopt -s extglob
stat -nf '%.9Fm%t%N/././%n' -- "${#//\/.\/+(.\/)//./}" |
awk -F '/\\./\\./' '{
if ( NF == 2 ) {
printf "%s%c", record $1, 0
record = ""
} else
record = record $1 "\n"
}'
N.B. If you wonder why I chose /././\n as record separator then take a look at Is it "safe" to replace each occurrence of (possibly overlapped) /./ with / in a path?
3. What you should do (accurate & fast):
You can use the following perl one‑liner on almost every UNIX/Linux:
LANG=C perl -MTime::HiRes=stat -e '
foreach (#ARGV) {
my #st = stat($_);
if ( #st > 0 ) {
printf "%.9f\t%s\0", $st[9], $_;
} else {
printf STDERR "stat: %s: %s\n", $_, $!;
}
}
' -- "$#"
note: for perl < 5.8.9, remove the -MTime::HiRes=stat from the command line.
ASIDE: There's a bug in BSD's stat:
When %N is at the end of the format string and the filename ends with a newline character, then its trailing newline might get stripped:
For example:
stat -f '%N' -- $'file1\n' file2
file1
file2
For getting the output that one would expect from stat -f '%N' you can use the -n switch and add an explicit %n at the end of the format string:
stat -nf '%N%n' -- $'file1\n' file2
file1
file2
Is there a way to work around that?
If all you need is to just replace all newlines with NULLs, then following tr should suffice
stat -f '%.9Fm %N' * | tr '\n' '\000'
Explanation: 000 is NULL expressed as octal value.
Is there a "canonical" way of doing that? I've been using head -n | tail -1 which does the trick, but I've been wondering if there's a Bash tool that specifically extracts a line (or a range of lines) from a file.
By "canonical" I mean a program whose main function is doing that.
head and pipe with tail will be slow for a huge file. I would suggest sed like this:
sed 'NUMq;d' file
Where NUM is the number of the line you want to print; so, for example, sed '10q;d' file to print the 10th line of file.
Explanation:
NUMq will quit immediately when the line number is NUM.
d will delete the line instead of printing it; this is inhibited on the last line because the q causes the rest of the script to be skipped when quitting.
If you have NUM in a variable, you will want to use double quotes instead of single:
sed "${NUM}q;d" file
sed -n '2p' < file.txt
will print 2nd line
sed -n '2011p' < file.txt
2011th line
sed -n '10,33p' < file.txt
line 10 up to line 33
sed -n '1p;3p' < file.txt
1st and 3th line
and so on...
For adding lines with sed, you can check this:
sed: insert a line in a certain position
I have a unique situation where I can benchmark the solutions proposed on this page, and so I'm writing this answer as a consolidation of the proposed solutions with included run times for each.
Set Up
I have a 3.261 gigabyte ASCII text data file with one key-value pair per row. The file contains 3,339,550,320 rows in total and defies opening in any editor I have tried, including my go-to Vim. I need to subset this file in order to investigate some of the values that I've discovered only start around row ~500,000,000.
Because the file has so many rows:
I need to extract only a subset of the rows to do anything useful with the data.
Reading through every row leading up to the values I care about is going to take a long time.
If the solution reads past the rows I care about and continues reading the rest of the file it will waste time reading almost 3 billion irrelevant rows and take 6x longer than necessary.
My best-case-scenario is a solution that extracts only a single line from the file without reading any of the other rows in the file, but I can't think of how I would accomplish this in Bash.
For the purposes of my sanity I'm not going to be trying to read the full 500,000,000 lines I'd need for my own problem. Instead I'll be trying to extract row 50,000,000 out of 3,339,550,320 (which means reading the full file will take 60x longer than necessary).
I will be using the time built-in to benchmark each command.
Baseline
First let's see how the head tail solution:
$ time head -50000000 myfile.ascii | tail -1
pgm_icnt = 0
real 1m15.321s
The baseline for row 50 million is 00:01:15.321, if I'd gone straight for row 500 million it'd probably be ~12.5 minutes.
cut
I'm dubious of this one, but it's worth a shot:
$ time cut -f50000000 -d$'\n' myfile.ascii
pgm_icnt = 0
real 5m12.156s
This one took 00:05:12.156 to run, which is much slower than the baseline! I'm not sure whether it read through the entire file or just up to line 50 million before stopping, but regardless this doesn't seem like a viable solution to the problem.
AWK
I only ran the solution with the exit because I wasn't going to wait for the full file to run:
$ time awk 'NR == 50000000 {print; exit}' myfile.ascii
pgm_icnt = 0
real 1m16.583s
This code ran in 00:01:16.583, which is only ~1 second slower, but still not an improvement on the baseline. At this rate if the exit command had been excluded it would have probably taken around ~76 minutes to read the entire file!
Perl
I ran the existing Perl solution as well:
$ time perl -wnl -e '$.== 50000000 && print && exit;' myfile.ascii
pgm_icnt = 0
real 1m13.146s
This code ran in 00:01:13.146, which is ~2 seconds faster than the baseline. If I'd run it on the full 500,000,000 it would probably take ~12 minutes.
sed
The top answer on the board, here's my result:
$ time sed "50000000q;d" myfile.ascii
pgm_icnt = 0
real 1m12.705s
This code ran in 00:01:12.705, which is 3 seconds faster than the baseline, and ~0.4 seconds faster than Perl. If I'd run it on the full 500,000,000 rows it would have probably taken ~12 minutes.
mapfile
I have bash 3.1 and therefore cannot test the mapfile solution.
Conclusion
It looks like, for the most part, it's difficult to improve upon the head tail solution. At best the sed solution provides a ~3% increase in efficiency.
(percentages calculated with the formula % = (runtime/baseline - 1) * 100)
Row 50,000,000
00:01:12.705 (-00:00:02.616 = -3.47%) sed
00:01:13.146 (-00:00:02.175 = -2.89%) perl
00:01:15.321 (+00:00:00.000 = +0.00%) head|tail
00:01:16.583 (+00:00:01.262 = +1.68%) awk
00:05:12.156 (+00:03:56.835 = +314.43%) cut
Row 500,000,000
00:12:07.050 (-00:00:26.160) sed
00:12:11.460 (-00:00:21.750) perl
00:12:33.210 (+00:00:00.000) head|tail
00:12:45.830 (+00:00:12.620) awk
00:52:01.560 (+00:40:31.650) cut
Row 3,338,559,320
01:20:54.599 (-00:03:05.327) sed
01:21:24.045 (-00:02:25.227) perl
01:23:49.273 (+00:00:00.000) head|tail
01:25:13.548 (+00:02:35.735) awk
05:47:23.026 (+04:24:26.246) cut
With awk it is pretty fast:
awk 'NR == num_line' file
When this is true, the default behaviour of awk is performed: {print $0}.
Alternative versions
If your file happens to be huge, you'd better exit after reading the required line. This way you save CPU time See time comparison at the end of the answer.
awk 'NR == num_line {print; exit}' file
If you want to give the line number from a bash variable you can use:
awk 'NR == n' n=$num file
awk -v n=$num 'NR == n' file # equivalent
See how much time is saved by using exit, specially if the line happens to be in the first part of the file:
# Let's create a 10M lines file
for ((i=0; i<100000; i++)); do echo "bla bla"; done > 100Klines
for ((i=0; i<100; i++)); do cat 100Klines; done > 10Mlines
$ time awk 'NR == 1234567 {print}' 10Mlines
bla bla
real 0m1.303s
user 0m1.246s
sys 0m0.042s
$ time awk 'NR == 1234567 {print; exit}' 10Mlines
bla bla
real 0m0.198s
user 0m0.178s
sys 0m0.013s
So the difference is 0.198s vs 1.303s, around 6x times faster.
According to my tests, in terms of performance and readability my recommendation is:
tail -n+N | head -1
N is the line number that you want. For example, tail -n+7 input.txt | head -1 will print the 7th line of the file.
tail -n+N will print everything starting from line N, and head -1 will make it stop after one line.
The alternative head -N | tail -1 is perhaps slightly more readable. For example, this will print the 7th line:
head -7 input.txt | tail -1
When it comes to performance, there is not much difference for smaller sizes, but it will be outperformed by the tail | head (from above) when the files become huge.
The top-voted sed 'NUMq;d' is interesting to know, but I would argue that it will be understood by fewer people out of the box than the head/tail solution and it is also slower than tail/head.
In my tests, both tails/heads versions outperformed sed 'NUMq;d' consistently. That is in line with the other benchmarks that were posted. It is hard to find a case where tails/heads was really bad. It is also not surprising, as these are operations that you would expect to be heavily optimized in a modern Unix system.
To get an idea about the performance differences, these are the number that I get for a huge file (9.3G):
tail -n+N | head -1: 3.7 sec
head -N | tail -1: 4.6 sec
sed Nq;d: 18.8 sec
Results may differ, but the performance head | tail and tail | head is, in general, comparable for smaller inputs, and sed is always slower by a significant factor (around 5x or so).
To reproduce my benchmark, you can try the following, but be warned that it will create a 9.3G file in the current working directory:
#!/bin/bash
readonly file=tmp-input.txt
readonly size=1000000000
readonly pos=500000000
readonly retries=3
seq 1 $size > $file
echo "*** head -N | tail -1 ***"
for i in $(seq 1 $retries) ; do
time head "-$pos" $file | tail -1
done
echo "-------------------------"
echo
echo "*** tail -n+N | head -1 ***"
echo
seq 1 $size > $file
ls -alhg $file
for i in $(seq 1 $retries) ; do
time tail -n+$pos $file | head -1
done
echo "-------------------------"
echo
echo "*** sed Nq;d ***"
echo
seq 1 $size > $file
ls -alhg $file
for i in $(seq 1 $retries) ; do
time sed $pos'q;d' $file
done
/bin/rm $file
Here is the output of a run on my machine (ThinkPad X1 Carbon with an SSD and 16G of memory). I assume in the final run everything will come from the cache, not from disk:
*** head -N | tail -1 ***
500000000
real 0m9,800s
user 0m7,328s
sys 0m4,081s
500000000
real 0m4,231s
user 0m5,415s
sys 0m2,789s
500000000
real 0m4,636s
user 0m5,935s
sys 0m2,684s
-------------------------
*** tail -n+N | head -1 ***
-rw-r--r-- 1 phil 9,3G Jan 19 19:49 tmp-input.txt
500000000
real 0m6,452s
user 0m3,367s
sys 0m1,498s
500000000
real 0m3,890s
user 0m2,921s
sys 0m0,952s
500000000
real 0m3,763s
user 0m3,004s
sys 0m0,760s
-------------------------
*** sed Nq;d ***
-rw-r--r-- 1 phil 9,3G Jan 19 19:50 tmp-input.txt
500000000
real 0m23,675s
user 0m21,557s
sys 0m1,523s
500000000
real 0m20,328s
user 0m18,971s
sys 0m1,308s
500000000
real 0m19,835s
user 0m18,830s
sys 0m1,004s
Wow, all the possibilities!
Try this:
sed -n "${lineNum}p" $file
or one of these depending upon your version of Awk:
awk -vlineNum=$lineNum 'NR == lineNum {print $0}' $file
awk -v lineNum=4 '{if (NR == lineNum) {print $0}}' $file
awk '{if (NR == lineNum) {print $0}}' lineNum=$lineNum $file
(You may have to try the nawk or gawk command).
Is there a tool that only does the print that particular line? Not one of the standard tools. However, sed is probably the closest and simplest to use.
Save two keystrokes, print Nth line without using bracket:
sed -n Np <fileName>
^ ^
\ \___ 'p' for printing
\______ '-n' for not printing by default
For example, to print 100th line:
sed -n 100p foo.txt
This question being tagged Bash, here's the Bash (≥4) way of doing: use mapfile with the -s (skip) and -n (count) option.
If you need to get the 42nd line of a file file:
mapfile -s 41 -n 1 ary < file
At this point, you'll have an array ary the fields of which containing the lines of file (including the trailing newline), where we have skipped the first 41 lines (-s 41), and stopped after reading one line (-n 1). So that's really the 42nd line. To print it out:
printf '%s' "${ary[0]}"
If you need a range of lines, say the range 42–666 (inclusive), and say you don't want to do the math yourself, and print them on stdout:
mapfile -s $((42-1)) -n $((666-42+1)) ary < file
printf '%s' "${ary[#]}"
If you need to process these lines too, it's not really convenient to store the trailing newline. In this case use the -t option (trim):
mapfile -t -s $((42-1)) -n $((666-42+1)) ary < file
# do stuff
printf '%s\n' "${ary[#]}"
You can have a function do that for you:
print_file_range() {
# $1-$2 is the range of file $3 to be printed to stdout
local ary
mapfile -s $(($1-1)) -n $(($2-$1+1)) ary < "$3"
printf '%s' "${ary[#]}"
}
No external commands, only Bash builtins!
You may also used sed print and quit:
sed -n '10{p;q;}' file # print line 10
You can also use Perl for this:
perl -wnl -e '$.== NUM && print && exit;' some.file
As a followup to CaffeineConnoisseur's very helpful benchmarking answer... I was curious as to how fast the 'mapfile' method was compared to others (as that wasn't tested), so I tried a quick-and-dirty speed comparison myself as I do have bash 4 handy. Threw in a test of the "tail | head" method (rather than head | tail) mentioned in one of the comments on the top answer while I was at it, as folks are singing its praises. I don't have anything nearly the size of the testfile used; the best I could find on short notice was a 14M pedigree file (long lines that are whitespace-separated, just under 12000 lines).
Short version: mapfile appears faster than the cut method, but slower than everything else, so I'd call it a dud. tail | head, OTOH, looks like it could be the fastest, although with a file this size the difference is not all that substantial compared to sed.
$ time head -11000 [filename] | tail -1
[output redacted]
real 0m0.117s
$ time cut -f11000 -d$'\n' [filename]
[output redacted]
real 0m1.081s
$ time awk 'NR == 11000 {print; exit}' [filename]
[output redacted]
real 0m0.058s
$ time perl -wnl -e '$.== 11000 && print && exit;' [filename]
[output redacted]
real 0m0.085s
$ time sed "11000q;d" [filename]
[output redacted]
real 0m0.031s
$ time (mapfile -s 11000 -n 1 ary < [filename]; echo ${ary[0]})
[output redacted]
real 0m0.309s
$ time tail -n+11000 [filename] | head -n1
[output redacted]
real 0m0.028s
Hope this helps!
The fastest solution for big files is always tail|head, provided that the two distances:
from the start of the file to the starting line. Lets call it S
the distance from the last line to the end of the file. Be it E
are known. Then, we could use this:
mycount="$E"; (( E > S )) && mycount="+$S"
howmany="$(( endline - startline + 1 ))"
tail -n "$mycount"| head -n "$howmany"
howmany is just the count of lines required.
Some more detail in https://unix.stackexchange.com/a/216614/79743
All the above answers directly answer the question. But here's a less direct solution but a potentially more important idea, to provoke thought.
Since line lengths are arbitrary, all the bytes of the file before the nth line need to be read. If you have a huge file or need to repeat this task many times, and this process is time-consuming, then you should seriously think about whether you should be storing your data in a different way in the first place.
The real solution is to have an index, e.g. at the start of the file, indicating the positions where the lines begin. You could use a database format, or just add a table at the start of the file. Alternatively create a separate index file to accompany your large text file.
e.g. you might create a list of character positions for newlines:
awk 'BEGIN{c=0;print(c)}{c+=length()+1;print(c+1)}' file.txt > file.idx
then read with tail, which actually seeks directly to the appropriate point in the file!
e.g. to get line 1000:
tail -c +$(awk 'NR=1000' file.idx) file.txt | head -1
This may not work with 2-byte / multibyte characters, since awk is "character-aware" but tail is not.
I haven't tested this against a large file.
Also see this answer.
Alternatively - split your file into smaller files!
If you got multiple lines by delimited by \n (normally new line). You can use 'cut' as well:
echo "$data" | cut -f2 -d$'\n'
You will get the 2nd line from the file. -f3 gives you the 3rd line.
Using what others mentioned, I wanted this to be a quick & dandy function in my bash shell.
Create a file: ~/.functions
Add to it the contents:
getline() {
line=$1
sed $line'q;d' $2
}
Then add this to your ~/.bash_profile:
source ~/.functions
Now when you open a new bash window, you can just call the function as so:
getline 441 myfile.txt
Lots of good answers already. I personally go with awk. For convenience, if you use bash, just add the below to your ~/.bash_profile. And, the next time you log in (or if you source your .bash_profile after this update), you will have a new nifty "nth" function available to pipe your files through.
Execute this or put it in your ~/.bash_profile (if using bash) and reopen bash (or execute source ~/.bach_profile)
# print just the nth piped in line
nth () { awk -vlnum=${1} 'NR==lnum {print; exit}'; }
Then, to use it, simply pipe through it. E.g.,:
$ yes line | cat -n | nth 5
5 line
To print nth line using sed with a variable as line number:
a=4
sed -e $a'q:d' file
Here the '-e' flag is for adding script to command to be executed.
After taking a look at the top answer and the benchmark, I've implemented a tiny helper function:
function nth {
if (( ${#} < 1 || ${#} > 2 )); then
echo -e "usage: $0 \e[4mline\e[0m [\e[4mfile\e[0m]"
return 1
fi
if (( ${#} > 1 )); then
sed "$1q;d" $2
else
sed "$1q;d"
fi
}
Basically you can use it in two fashions:
nth 42 myfile.txt
do_stuff | nth 42
This is not a bash solution, but I found out that top choices didn't satisfy my needs, eg,
sed 'NUMq;d' file
was fast enough, but was hanging for hours and did not tell about any progress. I suggest compiling this cpp program and using it to find the row you want. You can compile it with g++ main.cpp, where main.cpp is the file with the content below. I got a.out and executed it with ./a.out
#include <iostream>
#include <string>
#include <fstream>
using namespace std;
int main() {
string filename;
cout << "Enter filename ";
cin >> filename;
int needed_row_number;
cout << "Enter row number ";
cin >> needed_row_number;
int progress_line_count;
cout << "Enter at which every number of rows to monitor progress ";
cin >> progress_line_count;
char ch;
int row_counter = 1;
fstream fin(filename, fstream::in);
while (fin >> noskipws >> ch) {
int ch_int = (int) ch;
if (row_counter == needed_row_number) {
cout << ch;
}
if (ch_int == 10) {
if (row_counter == needed_row_number) {
return 0;
}
row_counter++;
if (row_counter % progress_line_count == 0) {
cout << "Progress: line " << row_counter << endl;
}
}
}
return 0;
}
To get an nth line (single line)
If you want something that you can later customize without having to deal with bash you can compile this c program and drop the binary in your custom binaries directory. This assumes that you know how to edit the .bashrc file
accordingly (only if you want to edit your path variable), If you don't know, this is a helpful link.
To run this code use (assuming you named the binary "line").
line [target line] [target file]
example
line 2 somefile.txt
The code:
#include <stdio.h>
#include <string.h>
#include <stdlib.h>
int main(int argc, char* argv[]){
if(argc != 3){
fprintf(stderr, "line needs a line number and a file name");
exit(0);
}
int lineNumber = atoi(argv[1]);
int counter = 0;
char *fileName = argv[2];
FILE *fileReader = fopen(fileName, "r");
if(fileReader == NULL){
fprintf(stderr, "Failed to open file");
exit(0);
}
size_t lineSize = 0;
char* line = NULL;
while(counter < lineNumber){
getline(&line, &linesize, fileReader);
counter++
}
getline(&line, &lineSize, fileReader);
printf("%s\n", line);
fclose(fileReader);
return 0;
}
EDIT: removed the fseek and replaced it with a while loop
I've put some of the above answers into a short bash script that you can put into a file called get.sh and link to /usr/local/bin/get (or whatever other name you prefer).
#!/bin/bash
if [ "${1}" == "" ]; then
echo "error: blank line number";
exit 1
fi
re='^[0-9]+$'
if ! [[ $1 =~ $re ]] ; then
echo "error: line number arg not a number";
exit 1
fi
if [ "${2}" == "" ]; then
echo "error: blank file name";
exit 1
fi
sed "${1}q;d" $2;
exit 0
Ensure it's executable with
$ chmod +x get
Link it to make it available on the PATH with
$ ln -s get.sh /usr/local/bin/get
UPDATE 1 : found much faster method in awk
just 5.353 secs to obtain a row above 133.6 mn :
rownum='133668997'; ( time ( pvE0 < ~/master_primelist_18a.txt |
LC_ALL=C mawk2 -F'^$' -v \_="${rownum}" -- '!_{exit}!--_' ) )
in0: 5.45GiB 0:00:05 [1.02GiB/s] [1.02GiB/s] [======> ] 71%
( pvE 0.1 in0 < ~/master_primelist_18a.txt |
LC_ALL=C mawk2 -F'^$' -v -- ; ) 5.01s user
1.21s system 116% cpu 5.353 total
77.37219=195591955519519519559551=0x296B0FA7D668C4A64F7F=
===============================================
I'd like to contest the notion that perl is faster than awk :
so while my test file isn't nearly quite as many rows, it's also twice the size, at 7.58 GB -
I even gave perl some built-in advantageous - like hard-coding in the row number, and also going second, thus gaining any potential speedups from OS caching mechanism, if any
f="$( grealpath -ePq ~/master_primelist_18a.txt )"
rownum='133668997'
fg;fg; pv < "${f}" | gwc -lcm
echo; sleep 2;
echo;
( time ( pv -i 0.1 -cN in0 < "${f}" |
LC_ALL=C mawk2 '_{exit}_=NR==+__' FS='^$' __="${rownum}"
) ) | mawk 'BEGIN { print } END { print _ } NR'
sleep 2
( time ( pv -i 0.1 -cN in0 < "${f}" |
LC_ALL=C perl -wnl -e '$.== 133668997 && print && exit;'
) ) | mawk 'BEGIN { print } END { print _ } NR' ;
fg: no current job
fg: no current job
7.58GiB 0:00:28 [ 275MiB/s] [============>] 100%
148,110,134 8,134,435,629 8,134,435,629 <<<< rows, chars, and bytes
count as reported by gnu-wc
in0: 5.45GiB 0:00:07 [ 701MiB/s] [=> ] 71%
( pv -i 0.1 -cN in0 < "${f}" | LC_ALL=C mawk2 '_{exit}_=NR==+__' FS='^$' ; )
6.22s user 2.56s system 110% cpu 7.966 total
77.37219=195591955519519519559551=0x296B0FA7D668C4A64F7F=
in0: 5.45GiB 0:00:17 [ 328MiB/s] [=> ] 71%
( pv -i 0.1 -cN in0 < "${f}" | LC_ALL=C perl -wnl -e ; )
14.22s user 3.31s system 103% cpu 17.014 total
77.37219=195591955519519519559551=0x296B0FA7D668C4A64F7F=
I can re-run the test with perl 5.36 or even perl-6 if u think it's gonna make a difference (haven't installed either), but a gap of
7.966 secs (mawk2) vs. 17.014 secs (perl 5.34)
between the two, with the latter more than double the prior, it seems clear which one is indeed meaningfully faster to fetch a single row way deep in ASCII files.
This is perl 5, version 34, subversion 0 (v5.34.0) built for darwin-thread-multi-2level
Copyright 1987-2021, Larry Wall
mawk 1.9.9.6, 21 Aug 2016, Copyright Michael D. Brennan
I'm looking for a way to merge 4 lines of dna probing results into one line.
The problem here is:
I don't want to append the lines. But associating them
The 4 lines of dna probing:
A----A----------A----A-A--AAAA-
-CC----CCCC-C-----CCC-C-------C
------G----G--G--G------G------
---TT--------T-T---------T-----
I need these to be 1 line, not just appended but intermixed without the dashes.
First characters of the result:
ACCTTAGCCCCGC...
This seem to be a kind of general problem, so the language choosed to solve this don't matter.
For fun: one bash way:
lines=(
A----A----------A----A-A--AAAA-
-CC----CCCC-C-----CCC-C-------C
------G----G--G--G------G------
---TT--------T-T---------T-----
)
result=""
for ((i=0;i<${#lines};i++)) ;do
chr=- c=()
for ((l=0;l<${#lines[#]};l++)) ;do
[ "${lines[l]:i:1}" != "-" ] &&
chr="${lines[l]:i:1}" &&
c+=($l)
done
[ ${#c[#]} -eq 0 ] && printf 'Char #%d not replaced.\n' $i
[ ${#c[#]} -gt 1 ] && c="${c[*]}" && chr="*" &&
printf "Conflict at char #%d (lines: %s).\n" $i "${c// /, }"
result+=$chr
done
echo $result
With provided input, there is no conflict and all characters is replaced. So the output is:
ACCTTAGCCCCGCTGTAGCCCACAGTAAAAC
Note: Question stand for 4 different files, so lines= syntax could be:
lines=($(cat file1 file2 file3 file4))
But with a wrong input:
lines=(
A----A---A-----A-----A-A--AAAA-
-CC----CCCC-C-----CCC-C-------C
------G----G---G-G------G------
---TT--------T-T---------T-----
)
output could be:
Conflict at char #9 (lines: 0, 1).
Char #14 not replaced.
Conflict at char #15 (lines: 0, 2, 3).
Char #16 not replaced.
and
echo $result
ACCTTAGCC*CGCT-*-GCCCACAGTAAAAC
Small perl filter
But if input are not to be verified, this little perl filter could do the job:
(Thanks #jm666 for }{ syntax)
perl -nlE 'y+-+\0+;$,|=$_}{say$,' <(cat file1 file2 file3 file4)
where
-n process all lines without output
-l whipe leading cariage return at end of lines
y+lhs+rhs+ replace (translate) chars from 'lhs' to 'rhs'
\0 is the *null* character, binary 0.
$, is a variable
|= binary or, between himself and current line ($_)
}{ at END, once all lines processed
Alternative way - not very efficient - but short:
file="./gene"
line1=$(head -1 "$file")
seq ${#line1} | xargs -n1 -I% cut -c% "$file" | paste -s - | tr -cd '[A-Z\n]'
prints:
ACCTTAGCCCCGCTGTAGCCCACAGTAAAAC
Assumption: each line has the same length.
Decomposition:
the line1=$(head -1 "$file") read the 1st line into the variable line1
the seq ${#line1} generate a sequence of numbers 1..char_count_in_the_line1, like
1
2
..
31
the xargs -n1 -I% cut -c% "$file" will run for each above number the command cut like cut -c22 filename - what extract the given column from the file, e.g. you will get output like:
A
-
-
-
-
C
-
-
# and so on
the paste -s - will join the above lines into one long line with the \t (tab) separator, like:
A - - - - C - - - C - - - - - T ... etc...
finally the tr -cd '[A-Z\n]' remove everything what isn't uppercase character or newline, so will get the final
ACCTTAGCCCCGCTGTAGCCCACAGTAAAAC
I'm currently working on a maths project and just run into a bit of a brick wall with programming in bash.
Currently I have a directory containing 800 texts files, and what I want to do is run a loop to cat the first 80 files (_01 through to _80) into a new file and save elsewhere, then the next 80 (_81 to _160) files etc.
all the files in the directory are listed like so: ath_01, ath_02, ath_03 etc.
Can anyone help?
So far I have:
#!/bin/bash
for file in /dir/*
do
echo ${file}
done
Which just simple lists my file. I know I need to use cat file1 file2 > newfile.txt somehow but it's confusing my with the numerated extension of _01, _02 etc.
Would it help if I changed the name of the file to use something other than an underscore? like ath.01 etc?
Cheers,
Since you know ahead of time how many files you have and how they are numbered, it may be easier to "unroll the loop", so to speak, and use copy-and-paste and a little hand-tweaking to write a script that uses brace expansion.
#!/bin/bash
cat ath_{001..080} > file1.txt
cat ath_{081..160} > file2.txt
cat ath_{161..240} > file3.txt
cat ath_{241..320} > file4.txt
cat ath_{321..400} > file5.txt
cat ath_{401..480} > file6.txt
cat ath_{481..560} > file7.txt
cat ath_{561..640} > file8.txt
cat ath_{641..720} > file9.txt
cat ath_{721..800} > file10.txt
Or else, use nested for-loops and the seq command
N=800
B=80
for n in $( seq 1 $B $N ); do
for i in $( seq $n $((n+B - 1)) ); do
cat ath_$i
done > file$((n/B + 1)).txt
done
The outer loop will iterate n through 1, 81, 161, etc. The inner loop will iterate i over 1 through 80, then 81 through 160, etc. The body of the inner loops just dumps the contents if the ith file to standard output, but the aggregated output of the loop is stored in file 1, then 2, etc.
You could try something like this:
cat "$file" >> "concat_$(( ${file#/dir/ath_} / 80 ))"
with ${file#/dir/ath_} you remove the prefix /dir/ath_ from the filename
$(( / 80 )) you get the suffix divided by 80 (integer division)
Also change the loop to
for file in /dir/ath_*
So you only get the files you need
If you want groups of 80 files, you'd do best to ensure that the names are sortable; that's why leading zeroes were often used. Assuming that you only have one underscore in the file names, and no newlines in the names, then:
SOURCE="/path/to/dir"
TARGET="/path/to/other/directory"
(
cd $SOURCE || exit 1
ls |
sort -t _ -k2,2n |
awk -v target="$TARGET" \
'{ file[n++] = $1
if (n >= 80)
{
printf "cat"
for (i = 0; i < 80; i++)
printf(" %s", file[i]
printf(" >%s/%s.%.2d\n", target, "newfile", ++number)
n = 0
}
END {
if (n > 0)
{
printf "cat"
for (i = 0; i < n; i++)
printf(" %s", file[i]
printf(" >%s/%s.%.2d\n", target, "newfile", ++number)
}
}' |
sh -x
)
The two directories are specified (where the files are and where the summaries should go); the command changes directory to the source directory (where the 800 files are). It lists the names (you could specify a glob pattern if you needed to) and sorts them numerically. The output is fed into awk which generates a shell script on the fly. It collects 80 names at a time, then generates a cat command that will copy those files to a single destination file such as "newfile.01"; tweak the printf() command to suit your own naming/numbering conventions. The shell commands are then passed to a shell for execution.
While testing, replace the sh -x with nothing, or sh -vn or something similar. Only add an active shell when you're sure it will do what you want. Remember, the shell script is in the source directory as it is running.
Superficially, the xargs command would be nice to use; the difficulty is coordinating the output file number. There might be a way to do that with the -n 80 option to group 80 files at a time and some fancy way to generate the invocation number, but I'm not aware of it.
Another option is to use xargs -n to execute a shell script that can deduce the correct output file number by listing what's already in the target directory. This would be cleaner in many ways:
SOURCE="/path/to/dir"
TARGET="/path/to/other/directory"
(
cd $SOURCE || exit 1
ls |
sort -t _ -k2,2n |
xargs -n 80 cpfiles "$TARGET"
)
Where cpfiles looks like:
TARGET="$1"
shift
if [ $# -gt 0 ]
then
old=$(ls -r newfile.?? | sed -n -e 's/newfile\.//p; 1q')
new=$(printf "%.2d" $((old + 1)))
cat "$#" > "$TARGET/newfile. $new
fi
The test for zero arguments avoids trouble with xargs executing the command once with zero arguments. On the whole, I prefer this solution to the one using awk.
Here's a macro for #chepner's first solution, using GNU Make as the templating language:
SHELL := /bin/bash
N = 800
B = 80
fileNums = $(shell seq 1 $$((${N}/${B})) )
files = ${fileNums:%=file%.txt}
all: ${files}
file%.txt : start = $(shell echo $$(( ($*-1)*${B}+1 )) )
file%.txt : end = $(shell echo $$(( $* * ${B} )) )
file%.txt:
cat ath_{${start}..${end}} > $#
To use:
$ make -n all
cat ath_{1..80} > file1.txt
cat ath_{81..160} > file2.txt
cat ath_{161..240} > file3.txt
cat ath_{241..320} > file4.txt
cat ath_{321..400} > file5.txt
cat ath_{401..480} > file6.txt
cat ath_{481..560} > file7.txt
cat ath_{561..640} > file8.txt
cat ath_{641..720} > file9.txt
cat ath_{721..800} > file10.txt
Is there a "canonical" way of doing that? I've been using head -n | tail -1 which does the trick, but I've been wondering if there's a Bash tool that specifically extracts a line (or a range of lines) from a file.
By "canonical" I mean a program whose main function is doing that.
head and pipe with tail will be slow for a huge file. I would suggest sed like this:
sed 'NUMq;d' file
Where NUM is the number of the line you want to print; so, for example, sed '10q;d' file to print the 10th line of file.
Explanation:
NUMq will quit immediately when the line number is NUM.
d will delete the line instead of printing it; this is inhibited on the last line because the q causes the rest of the script to be skipped when quitting.
If you have NUM in a variable, you will want to use double quotes instead of single:
sed "${NUM}q;d" file
sed -n '2p' < file.txt
will print 2nd line
sed -n '2011p' < file.txt
2011th line
sed -n '10,33p' < file.txt
line 10 up to line 33
sed -n '1p;3p' < file.txt
1st and 3th line
and so on...
For adding lines with sed, you can check this:
sed: insert a line in a certain position
I have a unique situation where I can benchmark the solutions proposed on this page, and so I'm writing this answer as a consolidation of the proposed solutions with included run times for each.
Set Up
I have a 3.261 gigabyte ASCII text data file with one key-value pair per row. The file contains 3,339,550,320 rows in total and defies opening in any editor I have tried, including my go-to Vim. I need to subset this file in order to investigate some of the values that I've discovered only start around row ~500,000,000.
Because the file has so many rows:
I need to extract only a subset of the rows to do anything useful with the data.
Reading through every row leading up to the values I care about is going to take a long time.
If the solution reads past the rows I care about and continues reading the rest of the file it will waste time reading almost 3 billion irrelevant rows and take 6x longer than necessary.
My best-case-scenario is a solution that extracts only a single line from the file without reading any of the other rows in the file, but I can't think of how I would accomplish this in Bash.
For the purposes of my sanity I'm not going to be trying to read the full 500,000,000 lines I'd need for my own problem. Instead I'll be trying to extract row 50,000,000 out of 3,339,550,320 (which means reading the full file will take 60x longer than necessary).
I will be using the time built-in to benchmark each command.
Baseline
First let's see how the head tail solution:
$ time head -50000000 myfile.ascii | tail -1
pgm_icnt = 0
real 1m15.321s
The baseline for row 50 million is 00:01:15.321, if I'd gone straight for row 500 million it'd probably be ~12.5 minutes.
cut
I'm dubious of this one, but it's worth a shot:
$ time cut -f50000000 -d$'\n' myfile.ascii
pgm_icnt = 0
real 5m12.156s
This one took 00:05:12.156 to run, which is much slower than the baseline! I'm not sure whether it read through the entire file or just up to line 50 million before stopping, but regardless this doesn't seem like a viable solution to the problem.
AWK
I only ran the solution with the exit because I wasn't going to wait for the full file to run:
$ time awk 'NR == 50000000 {print; exit}' myfile.ascii
pgm_icnt = 0
real 1m16.583s
This code ran in 00:01:16.583, which is only ~1 second slower, but still not an improvement on the baseline. At this rate if the exit command had been excluded it would have probably taken around ~76 minutes to read the entire file!
Perl
I ran the existing Perl solution as well:
$ time perl -wnl -e '$.== 50000000 && print && exit;' myfile.ascii
pgm_icnt = 0
real 1m13.146s
This code ran in 00:01:13.146, which is ~2 seconds faster than the baseline. If I'd run it on the full 500,000,000 it would probably take ~12 minutes.
sed
The top answer on the board, here's my result:
$ time sed "50000000q;d" myfile.ascii
pgm_icnt = 0
real 1m12.705s
This code ran in 00:01:12.705, which is 3 seconds faster than the baseline, and ~0.4 seconds faster than Perl. If I'd run it on the full 500,000,000 rows it would have probably taken ~12 minutes.
mapfile
I have bash 3.1 and therefore cannot test the mapfile solution.
Conclusion
It looks like, for the most part, it's difficult to improve upon the head tail solution. At best the sed solution provides a ~3% increase in efficiency.
(percentages calculated with the formula % = (runtime/baseline - 1) * 100)
Row 50,000,000
00:01:12.705 (-00:00:02.616 = -3.47%) sed
00:01:13.146 (-00:00:02.175 = -2.89%) perl
00:01:15.321 (+00:00:00.000 = +0.00%) head|tail
00:01:16.583 (+00:00:01.262 = +1.68%) awk
00:05:12.156 (+00:03:56.835 = +314.43%) cut
Row 500,000,000
00:12:07.050 (-00:00:26.160) sed
00:12:11.460 (-00:00:21.750) perl
00:12:33.210 (+00:00:00.000) head|tail
00:12:45.830 (+00:00:12.620) awk
00:52:01.560 (+00:40:31.650) cut
Row 3,338,559,320
01:20:54.599 (-00:03:05.327) sed
01:21:24.045 (-00:02:25.227) perl
01:23:49.273 (+00:00:00.000) head|tail
01:25:13.548 (+00:02:35.735) awk
05:47:23.026 (+04:24:26.246) cut
With awk it is pretty fast:
awk 'NR == num_line' file
When this is true, the default behaviour of awk is performed: {print $0}.
Alternative versions
If your file happens to be huge, you'd better exit after reading the required line. This way you save CPU time See time comparison at the end of the answer.
awk 'NR == num_line {print; exit}' file
If you want to give the line number from a bash variable you can use:
awk 'NR == n' n=$num file
awk -v n=$num 'NR == n' file # equivalent
See how much time is saved by using exit, specially if the line happens to be in the first part of the file:
# Let's create a 10M lines file
for ((i=0; i<100000; i++)); do echo "bla bla"; done > 100Klines
for ((i=0; i<100; i++)); do cat 100Klines; done > 10Mlines
$ time awk 'NR == 1234567 {print}' 10Mlines
bla bla
real 0m1.303s
user 0m1.246s
sys 0m0.042s
$ time awk 'NR == 1234567 {print; exit}' 10Mlines
bla bla
real 0m0.198s
user 0m0.178s
sys 0m0.013s
So the difference is 0.198s vs 1.303s, around 6x times faster.
According to my tests, in terms of performance and readability my recommendation is:
tail -n+N | head -1
N is the line number that you want. For example, tail -n+7 input.txt | head -1 will print the 7th line of the file.
tail -n+N will print everything starting from line N, and head -1 will make it stop after one line.
The alternative head -N | tail -1 is perhaps slightly more readable. For example, this will print the 7th line:
head -7 input.txt | tail -1
When it comes to performance, there is not much difference for smaller sizes, but it will be outperformed by the tail | head (from above) when the files become huge.
The top-voted sed 'NUMq;d' is interesting to know, but I would argue that it will be understood by fewer people out of the box than the head/tail solution and it is also slower than tail/head.
In my tests, both tails/heads versions outperformed sed 'NUMq;d' consistently. That is in line with the other benchmarks that were posted. It is hard to find a case where tails/heads was really bad. It is also not surprising, as these are operations that you would expect to be heavily optimized in a modern Unix system.
To get an idea about the performance differences, these are the number that I get for a huge file (9.3G):
tail -n+N | head -1: 3.7 sec
head -N | tail -1: 4.6 sec
sed Nq;d: 18.8 sec
Results may differ, but the performance head | tail and tail | head is, in general, comparable for smaller inputs, and sed is always slower by a significant factor (around 5x or so).
To reproduce my benchmark, you can try the following, but be warned that it will create a 9.3G file in the current working directory:
#!/bin/bash
readonly file=tmp-input.txt
readonly size=1000000000
readonly pos=500000000
readonly retries=3
seq 1 $size > $file
echo "*** head -N | tail -1 ***"
for i in $(seq 1 $retries) ; do
time head "-$pos" $file | tail -1
done
echo "-------------------------"
echo
echo "*** tail -n+N | head -1 ***"
echo
seq 1 $size > $file
ls -alhg $file
for i in $(seq 1 $retries) ; do
time tail -n+$pos $file | head -1
done
echo "-------------------------"
echo
echo "*** sed Nq;d ***"
echo
seq 1 $size > $file
ls -alhg $file
for i in $(seq 1 $retries) ; do
time sed $pos'q;d' $file
done
/bin/rm $file
Here is the output of a run on my machine (ThinkPad X1 Carbon with an SSD and 16G of memory). I assume in the final run everything will come from the cache, not from disk:
*** head -N | tail -1 ***
500000000
real 0m9,800s
user 0m7,328s
sys 0m4,081s
500000000
real 0m4,231s
user 0m5,415s
sys 0m2,789s
500000000
real 0m4,636s
user 0m5,935s
sys 0m2,684s
-------------------------
*** tail -n+N | head -1 ***
-rw-r--r-- 1 phil 9,3G Jan 19 19:49 tmp-input.txt
500000000
real 0m6,452s
user 0m3,367s
sys 0m1,498s
500000000
real 0m3,890s
user 0m2,921s
sys 0m0,952s
500000000
real 0m3,763s
user 0m3,004s
sys 0m0,760s
-------------------------
*** sed Nq;d ***
-rw-r--r-- 1 phil 9,3G Jan 19 19:50 tmp-input.txt
500000000
real 0m23,675s
user 0m21,557s
sys 0m1,523s
500000000
real 0m20,328s
user 0m18,971s
sys 0m1,308s
500000000
real 0m19,835s
user 0m18,830s
sys 0m1,004s
Wow, all the possibilities!
Try this:
sed -n "${lineNum}p" $file
or one of these depending upon your version of Awk:
awk -vlineNum=$lineNum 'NR == lineNum {print $0}' $file
awk -v lineNum=4 '{if (NR == lineNum) {print $0}}' $file
awk '{if (NR == lineNum) {print $0}}' lineNum=$lineNum $file
(You may have to try the nawk or gawk command).
Is there a tool that only does the print that particular line? Not one of the standard tools. However, sed is probably the closest and simplest to use.
Save two keystrokes, print Nth line without using bracket:
sed -n Np <fileName>
^ ^
\ \___ 'p' for printing
\______ '-n' for not printing by default
For example, to print 100th line:
sed -n 100p foo.txt
This question being tagged Bash, here's the Bash (≥4) way of doing: use mapfile with the -s (skip) and -n (count) option.
If you need to get the 42nd line of a file file:
mapfile -s 41 -n 1 ary < file
At this point, you'll have an array ary the fields of which containing the lines of file (including the trailing newline), where we have skipped the first 41 lines (-s 41), and stopped after reading one line (-n 1). So that's really the 42nd line. To print it out:
printf '%s' "${ary[0]}"
If you need a range of lines, say the range 42–666 (inclusive), and say you don't want to do the math yourself, and print them on stdout:
mapfile -s $((42-1)) -n $((666-42+1)) ary < file
printf '%s' "${ary[#]}"
If you need to process these lines too, it's not really convenient to store the trailing newline. In this case use the -t option (trim):
mapfile -t -s $((42-1)) -n $((666-42+1)) ary < file
# do stuff
printf '%s\n' "${ary[#]}"
You can have a function do that for you:
print_file_range() {
# $1-$2 is the range of file $3 to be printed to stdout
local ary
mapfile -s $(($1-1)) -n $(($2-$1+1)) ary < "$3"
printf '%s' "${ary[#]}"
}
No external commands, only Bash builtins!
You may also used sed print and quit:
sed -n '10{p;q;}' file # print line 10
You can also use Perl for this:
perl -wnl -e '$.== NUM && print && exit;' some.file
As a followup to CaffeineConnoisseur's very helpful benchmarking answer... I was curious as to how fast the 'mapfile' method was compared to others (as that wasn't tested), so I tried a quick-and-dirty speed comparison myself as I do have bash 4 handy. Threw in a test of the "tail | head" method (rather than head | tail) mentioned in one of the comments on the top answer while I was at it, as folks are singing its praises. I don't have anything nearly the size of the testfile used; the best I could find on short notice was a 14M pedigree file (long lines that are whitespace-separated, just under 12000 lines).
Short version: mapfile appears faster than the cut method, but slower than everything else, so I'd call it a dud. tail | head, OTOH, looks like it could be the fastest, although with a file this size the difference is not all that substantial compared to sed.
$ time head -11000 [filename] | tail -1
[output redacted]
real 0m0.117s
$ time cut -f11000 -d$'\n' [filename]
[output redacted]
real 0m1.081s
$ time awk 'NR == 11000 {print; exit}' [filename]
[output redacted]
real 0m0.058s
$ time perl -wnl -e '$.== 11000 && print && exit;' [filename]
[output redacted]
real 0m0.085s
$ time sed "11000q;d" [filename]
[output redacted]
real 0m0.031s
$ time (mapfile -s 11000 -n 1 ary < [filename]; echo ${ary[0]})
[output redacted]
real 0m0.309s
$ time tail -n+11000 [filename] | head -n1
[output redacted]
real 0m0.028s
Hope this helps!
The fastest solution for big files is always tail|head, provided that the two distances:
from the start of the file to the starting line. Lets call it S
the distance from the last line to the end of the file. Be it E
are known. Then, we could use this:
mycount="$E"; (( E > S )) && mycount="+$S"
howmany="$(( endline - startline + 1 ))"
tail -n "$mycount"| head -n "$howmany"
howmany is just the count of lines required.
Some more detail in https://unix.stackexchange.com/a/216614/79743
All the above answers directly answer the question. But here's a less direct solution but a potentially more important idea, to provoke thought.
Since line lengths are arbitrary, all the bytes of the file before the nth line need to be read. If you have a huge file or need to repeat this task many times, and this process is time-consuming, then you should seriously think about whether you should be storing your data in a different way in the first place.
The real solution is to have an index, e.g. at the start of the file, indicating the positions where the lines begin. You could use a database format, or just add a table at the start of the file. Alternatively create a separate index file to accompany your large text file.
e.g. you might create a list of character positions for newlines:
awk 'BEGIN{c=0;print(c)}{c+=length()+1;print(c+1)}' file.txt > file.idx
then read with tail, which actually seeks directly to the appropriate point in the file!
e.g. to get line 1000:
tail -c +$(awk 'NR=1000' file.idx) file.txt | head -1
This may not work with 2-byte / multibyte characters, since awk is "character-aware" but tail is not.
I haven't tested this against a large file.
Also see this answer.
Alternatively - split your file into smaller files!
If you got multiple lines by delimited by \n (normally new line). You can use 'cut' as well:
echo "$data" | cut -f2 -d$'\n'
You will get the 2nd line from the file. -f3 gives you the 3rd line.
Using what others mentioned, I wanted this to be a quick & dandy function in my bash shell.
Create a file: ~/.functions
Add to it the contents:
getline() {
line=$1
sed $line'q;d' $2
}
Then add this to your ~/.bash_profile:
source ~/.functions
Now when you open a new bash window, you can just call the function as so:
getline 441 myfile.txt
Lots of good answers already. I personally go with awk. For convenience, if you use bash, just add the below to your ~/.bash_profile. And, the next time you log in (or if you source your .bash_profile after this update), you will have a new nifty "nth" function available to pipe your files through.
Execute this or put it in your ~/.bash_profile (if using bash) and reopen bash (or execute source ~/.bach_profile)
# print just the nth piped in line
nth () { awk -vlnum=${1} 'NR==lnum {print; exit}'; }
Then, to use it, simply pipe through it. E.g.,:
$ yes line | cat -n | nth 5
5 line
To print nth line using sed with a variable as line number:
a=4
sed -e $a'q:d' file
Here the '-e' flag is for adding script to command to be executed.
After taking a look at the top answer and the benchmark, I've implemented a tiny helper function:
function nth {
if (( ${#} < 1 || ${#} > 2 )); then
echo -e "usage: $0 \e[4mline\e[0m [\e[4mfile\e[0m]"
return 1
fi
if (( ${#} > 1 )); then
sed "$1q;d" $2
else
sed "$1q;d"
fi
}
Basically you can use it in two fashions:
nth 42 myfile.txt
do_stuff | nth 42
This is not a bash solution, but I found out that top choices didn't satisfy my needs, eg,
sed 'NUMq;d' file
was fast enough, but was hanging for hours and did not tell about any progress. I suggest compiling this cpp program and using it to find the row you want. You can compile it with g++ main.cpp, where main.cpp is the file with the content below. I got a.out and executed it with ./a.out
#include <iostream>
#include <string>
#include <fstream>
using namespace std;
int main() {
string filename;
cout << "Enter filename ";
cin >> filename;
int needed_row_number;
cout << "Enter row number ";
cin >> needed_row_number;
int progress_line_count;
cout << "Enter at which every number of rows to monitor progress ";
cin >> progress_line_count;
char ch;
int row_counter = 1;
fstream fin(filename, fstream::in);
while (fin >> noskipws >> ch) {
int ch_int = (int) ch;
if (row_counter == needed_row_number) {
cout << ch;
}
if (ch_int == 10) {
if (row_counter == needed_row_number) {
return 0;
}
row_counter++;
if (row_counter % progress_line_count == 0) {
cout << "Progress: line " << row_counter << endl;
}
}
}
return 0;
}
To get an nth line (single line)
If you want something that you can later customize without having to deal with bash you can compile this c program and drop the binary in your custom binaries directory. This assumes that you know how to edit the .bashrc file
accordingly (only if you want to edit your path variable), If you don't know, this is a helpful link.
To run this code use (assuming you named the binary "line").
line [target line] [target file]
example
line 2 somefile.txt
The code:
#include <stdio.h>
#include <string.h>
#include <stdlib.h>
int main(int argc, char* argv[]){
if(argc != 3){
fprintf(stderr, "line needs a line number and a file name");
exit(0);
}
int lineNumber = atoi(argv[1]);
int counter = 0;
char *fileName = argv[2];
FILE *fileReader = fopen(fileName, "r");
if(fileReader == NULL){
fprintf(stderr, "Failed to open file");
exit(0);
}
size_t lineSize = 0;
char* line = NULL;
while(counter < lineNumber){
getline(&line, &linesize, fileReader);
counter++
}
getline(&line, &lineSize, fileReader);
printf("%s\n", line);
fclose(fileReader);
return 0;
}
EDIT: removed the fseek and replaced it with a while loop
I've put some of the above answers into a short bash script that you can put into a file called get.sh and link to /usr/local/bin/get (or whatever other name you prefer).
#!/bin/bash
if [ "${1}" == "" ]; then
echo "error: blank line number";
exit 1
fi
re='^[0-9]+$'
if ! [[ $1 =~ $re ]] ; then
echo "error: line number arg not a number";
exit 1
fi
if [ "${2}" == "" ]; then
echo "error: blank file name";
exit 1
fi
sed "${1}q;d" $2;
exit 0
Ensure it's executable with
$ chmod +x get
Link it to make it available on the PATH with
$ ln -s get.sh /usr/local/bin/get
UPDATE 1 : found much faster method in awk
just 5.353 secs to obtain a row above 133.6 mn :
rownum='133668997'; ( time ( pvE0 < ~/master_primelist_18a.txt |
LC_ALL=C mawk2 -F'^$' -v \_="${rownum}" -- '!_{exit}!--_' ) )
in0: 5.45GiB 0:00:05 [1.02GiB/s] [1.02GiB/s] [======> ] 71%
( pvE 0.1 in0 < ~/master_primelist_18a.txt |
LC_ALL=C mawk2 -F'^$' -v -- ; ) 5.01s user
1.21s system 116% cpu 5.353 total
77.37219=195591955519519519559551=0x296B0FA7D668C4A64F7F=
===============================================
I'd like to contest the notion that perl is faster than awk :
so while my test file isn't nearly quite as many rows, it's also twice the size, at 7.58 GB -
I even gave perl some built-in advantageous - like hard-coding in the row number, and also going second, thus gaining any potential speedups from OS caching mechanism, if any
f="$( grealpath -ePq ~/master_primelist_18a.txt )"
rownum='133668997'
fg;fg; pv < "${f}" | gwc -lcm
echo; sleep 2;
echo;
( time ( pv -i 0.1 -cN in0 < "${f}" |
LC_ALL=C mawk2 '_{exit}_=NR==+__' FS='^$' __="${rownum}"
) ) | mawk 'BEGIN { print } END { print _ } NR'
sleep 2
( time ( pv -i 0.1 -cN in0 < "${f}" |
LC_ALL=C perl -wnl -e '$.== 133668997 && print && exit;'
) ) | mawk 'BEGIN { print } END { print _ } NR' ;
fg: no current job
fg: no current job
7.58GiB 0:00:28 [ 275MiB/s] [============>] 100%
148,110,134 8,134,435,629 8,134,435,629 <<<< rows, chars, and bytes
count as reported by gnu-wc
in0: 5.45GiB 0:00:07 [ 701MiB/s] [=> ] 71%
( pv -i 0.1 -cN in0 < "${f}" | LC_ALL=C mawk2 '_{exit}_=NR==+__' FS='^$' ; )
6.22s user 2.56s system 110% cpu 7.966 total
77.37219=195591955519519519559551=0x296B0FA7D668C4A64F7F=
in0: 5.45GiB 0:00:17 [ 328MiB/s] [=> ] 71%
( pv -i 0.1 -cN in0 < "${f}" | LC_ALL=C perl -wnl -e ; )
14.22s user 3.31s system 103% cpu 17.014 total
77.37219=195591955519519519559551=0x296B0FA7D668C4A64F7F=
I can re-run the test with perl 5.36 or even perl-6 if u think it's gonna make a difference (haven't installed either), but a gap of
7.966 secs (mawk2) vs. 17.014 secs (perl 5.34)
between the two, with the latter more than double the prior, it seems clear which one is indeed meaningfully faster to fetch a single row way deep in ASCII files.
This is perl 5, version 34, subversion 0 (v5.34.0) built for darwin-thread-multi-2level
Copyright 1987-2021, Larry Wall
mawk 1.9.9.6, 21 Aug 2016, Copyright Michael D. Brennan