I have below for loop in shell script
#!/bin/bash
#Get the year
curr_year=$(date +"%Y")
FILE_NAME=/test/codebase/wt.properties
key=wt.cache.master.slaveHosts=
prop_value=""
getproperty(){
prop_key=$1
prop_value=`cat ${FILE_NAME} | grep ${prop_key} | cut -d'=' -f2`
}
#echo ${prop_value}
getproperty ${key}
#echo "Key = ${key}; Value="${prop_value}
arr=( $prop_value )
for i in "${arr[#]}"; do
echo $i | head -n1 | cut -d "." -f1
done
The output I am getting is as below.
test1
test2
test3
I want to process the test2 from above results to below script in place of 'ABCD'
grep test12345 /home/ptc/storage/**'ABCD'**/apache/$curr_year/logs/access.log* | grep GET > /tmp/test.access.txt
I tried all the options but could not able to succeed as I am new to shell scripting.
Ignoring the many bugs elsewhere and focusing on the one piece of code you say you want to change:
for i in "${arr[#]}"; do
val=$(echo "$i" | head -n1 | cut -d "." -f1)
grep test12345 /dev/null "/home/ptc/storage/$val/apache/$curr_year/logs/access.log"* \
| grep GET
done > /tmp/test.access.txt
Notes:
Always quote your expansions. "$i", "/path/with/$val/"*, etc. (The * should not be quoted on the assumption that you want it to be expanded).
for i in $prop_value would have the exact same (buggy) behavior; using arr buys you nothing. If you want using arr to increase correctness, populate it correctly: read -r -a arr <<<"$prop_value"
The redirection is moved outside the loop -- that way the second iteration through the loop doesn't overwrite the file written by the first one.
The extra /dev/null passed to grep ensures that its behavior is consistent regardless of the number of matches; otherwise, it would display filenames only if more than one matching log file existed, and not otherwise.
Related
I wrote a script to change specific lines in one text files (fasta format) and I want to parallelize because there is a lot of lines (~800k).
>CTC14_37541|M00842:336:000000000-C7WWK:1:2101:20913:9309:0:66|o:97|mo:0.000000|MR:n=0;r1=0;r2=0|Q30:p=75;p=71|CO
And I want to transform it to:
>Sample-CTC14_Read37541
I have two problems.
I tried to run my script with and without function:
Without function, it works: all the lines I want to change are modified.
When I use a function, only one line is modified. Something is wrong in my function header()?
Second problem is the parallelization. I tried something with "&" but I'm not sure that is the best solution. Any idea?
My code without function and parallel:
#!/bin/bash
TMP_PATH="/path/where/is/my/fasta"
cd $TMP_PATH
for fasta in *.fasta
do
echo $fasta
lines=$(grep ">" $fasta)
for line in $lines
do
if [[ $line = *">"* ]]; then
read_nb="_Read"$(echo $line | cut -d'|' -f1 | cut -d'_' -f2)
sample=$(echo $line | cut -d'_' -f1 | cut -d'>' -f2)
newheader=$(echo ">Sample-$sample$read_nb")
sed -i -e "s/$line/$newheader/g" $fasta
sed -i -e "s/ /\n/g" $fasta
fi
done
done
echo "END"
My code with function and parallel:
#!/bin/bash
TMP_PATH="/path/where/is/my/fasta"
cd $TMP_PATH
n=0
maxjobs=500
header(){
if [[ $line = *">"* ]]; then
read_nb="_Read"$(echo $line | cut -d'|' -f1 | cut -d'_' -f2)
sample=$(echo $line | cut -d'_' -f1 | cut -d'>' -f2)
newheader=$(echo ">Sample-$sample$read_nb")
sed -i -e "s/$line/$newheader/g" $fasta
sed -i -e "s/ /\n/g" $fasta
fi
}
for fasta in *.fasta
do
lines=$(grep ">" $fasta)
for line in $lines
do
header $line &
#limit jobs
if (( $(($((++n)) % $maxjobs)) == 0 )) ; then
wait
echo $n wait
fi
done
done
I have a fasta file as input that contains several headers and sequences. And I want to transform headers in order to use my fasta file in a specific workflow. I need to go from that :
>CTC14_18758|M00842:336:000000000-C7WWK:1:1108:17474:5670:0:66|o:98|mo:0.000000|MR:n=0;r1=0;r2=0|Q30:p=66;p=62|CO:0|
TGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCATGAGTGAAGAAGGCCTTTGGGTTGTAAAGCTCTTTTAGTGAGGAAGATAATGACGGTACTCACAGAAGAAGTCCTGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGAGGGCTAGCGTTATTCGGAATTATTGGGCGTAAAGGGCGCGTAGGCTGGTTAATAAGTTAAAAGTGAAATCCCGAGGCTTAACCTTGGAATTGCTTTTAAAACTATTAATCTAGAGATTGAAAGAGGATAGAGGAATTCCTGATGTAGAGGTAAAATTCGTAAATATTAGGAGGAACACCAGCGGCGAAGGCGTCTATCTGGTTCAAATCTGACGCTGAAGCGCGAAGGCTTGGGGAGCAAACAGG
>CTC14_20535|M00842:336:000000000-C7WWK:1:1108:28568:20175:0:66|o:97|mo:0.000000|MR:n=0;r1=0;r2=0|Q30:p=77;p=64|CO:0|
TGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCATGAGTGAAGAAGGCCTTTGGGTTGTAAAGCTCTTTTAGTGAGGAAGATAATGACGGTACCCACAGAAGAAGTCCTGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGAGGGCTAGCGTTATTCGGAATTATTGGGCGTAAAGGGCGCGTAGGCTGGTTAATAAGTTAAAAGTGAAATCCCGAGGCTTAACCTTGGAATTGCTTTTAAAACTATTAATCTAGAGATTGAAAGAGGATAGAGGAATTCCTGATGTAGAGGTAAAATTCGTAAATATTAGGAGGAACACCAGTGGCGAAGGCGTCTATCTGGTTCAAATCTGACGCTGAAGCGCGAAGGCGTGGGGAGCAAACAGG
>CTC14_24700|M00842:336:000000000-C7WWK:1:1110:7911:9824:0:66|o:97|mo:0.000000|MR:n=0;r1=0;r2=0|Q30:p=77;p=71|CO:0|
TGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCATGAGTGAAGAAGGCCTTTGGGTTGTAAAGCTCTTTTAGTGAGGAAGATAATGACGGTACTCACAGAAGAAGTCCTGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGAGGGCTAGCGTTATTCGGAATTATTGGGCGTAAAGGGCGCGTAGGCTGGTTAATAAGTTAAAAGTGAAATCCCGAGGCTTAACCTTGGAATTGCTTTTAAAACTATTAATCTAGAGATTGAAAGAGGATAGAGGAATTCCTGATGTAGAGGTAAAATTCGTAAATATTAGGAGGAACACCAGTGGCGAAGGCGTCTATCTGGTTCAAATCTGACGCTGAAGCGCGAAGGCGTGGGGAGCAAACAGG
To this:
>Sample-CTC14_Read18758
TGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCATGAGTGAAGAAGGCCTTTGGGTTGTAAAGCTCTTTTAGTGAGGAAGATAATGACGGTACTCACAGAAGAAGTCCTGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGAGGGCTAGCGTTATTCGGAATTATTGGGCGTAAAGGGCGCGTAGGCTGGTTAATAAGTTAAAAGTGAAATCCCGAGGCTTAACCTTGGAATTGCTTTTAAAACTATTAATCTAGAGATTGAAAGAGGATAGAGGAATTCCTGATGTAGAGGTAAAATTCGTAAATATTAGGAGGAACACCAGCGGCGAAGGCGTCTATCTGGTTCAAATCTGACGCTGAAGCGCGAAGGCTTGGGGAGCAAACAGG
>Sample-CTC14_Read20535
TGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCATGAGTGAAGAAGGCCTTTGGGTTGTAAAGCTCTTTTAGTGAGGAAGATAATGACGGTACCCACAGAAGAAGTCCTGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGAGGGCTAGCGTTATTCGGAATTATTGGGCGTAAAGGGCGCGTAGGCTGGTTAATAAGTTAAAAGTGAAATCCCGAGGCTTAACCTTGGAATTGCTTTTAAAACTATTAATCTAGAGATTGAAAGAGGATAGAGGAATTCCTGATGTAGAGGTAAAATTCGTAAATATTAGGAGGAACACCAGTGGCGAAGGCGTCTATCTGGTTCAAATCTGACGCTGAAGCGCGAAGGCGTGGGGAGCAAACAGG
>Sample-CTC14_Read24700
TGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCATGAGTGAAGAAGGCCTTTGGGTTGTAAAGCTCTTTTAGTGAGGAAGATAATGACGGTACTCACAGAAGAAGTCCTGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGAGGGCTAGCGTTATTCGGAATTATTGGGCGTAAAGGGCGCGTAGGCTGGTTAATAAGTTAAAAGTGAAATCCCGAGGCTTAACCTTGGAATTGCTTTTAAAACTATTAATCTAGAGATTGAAAGAGGATAGAGGAATTCCTGATGTAGAGGTAAAATTCGTAAATATTAGGAGGAACACCAGTGGCGAAGGCGTCTATCTGGTTCAAATCTGACGCTGAAGCGCGAAGGCGTGGGGAGCAAACAGG
And I want to make this parallel because I have a lot of lines to change (~700-800k) and it takes very long time if I run the script line by line.
With my script without function, job is works but it's too long.
With my script with function and parallel, job doesn't work fine because only one header is changed in my fasta instead of all headers and I don't understand why. I tried different ways to write and call my function but the result is always the same.
Moreover, I tried with the gnu-parallel but it's the same way. I think my function or my call have a problem but I don't understand where.
I think use awk as you suggested is a good idea but I'm not comfortable with it. Can you help me please?
Proper format of my fasta file is:
>CTC14_1600|M00842:336:000000000-C7WWK:1:1101:26089:18004:0:66|o:97|mo:0.000000|MR:n=0;r1=0;r2=0|Q30:p=77;p=71|CO:0| TGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCATGAGTGAAGAAGGCCTTTGGGTTGTAAAGCTCTTTTAGTGAGGAAGATAATGACGGTACTCACAGAAGAAGTCCTGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGAGGGCTAGCGTTATTCGGAATTATTGGGCGTAAAGGGCGCGTAGGCTGGTTAATAAGTTAAAAGTGAAATCCCGAGGCTTAACCTTGGAATTGCTTTTAAAACTATTAATCTAGAGATTGAAAGAGGATAGAGGAATTCCTGACGTAGAGGTAAAATTCGTAAATATTAGGAGGAACACCAGTGGCGAAGGCGTCTATCTGGTTCAAATCTGACGCTGAAGCGCGAAGGCGTGGGGAGCAAACAGG$
>CTC14_11169|M00842:336:000000000-C7WWK:1:1105:11636:11876:0:66|o:97|mo:0.000000|MR:n=0;r1=0;r2=0|Q30:p=76;p=65|CO:0| TGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCATGAGTGAAGAAGGCCTTTGGGTTGTAAAGCTCTTTTAGTGAGGAAGATAATGACGGTACTCACAGAAGAAGTCCTGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGAGGGCTAGCGTTATTCGGAATTATTGGGCGTAAAGGGCGCGTAGGCTGGTTAATAAGTTAAAAGTGAAATCCCGAGGCTTAACCTTGGAATTGCTTTTAAAACTATTAATCTAGAGATTGAAAGAGGATAGAGGAATTCCTGATGTAGAGGTAAAATTCGTAAATATTAGGAGGAACACCAGTGGCGAAGGCGTCTATCTGGTTCAAATCTGACGCTGAAGCGCGAAGGCGTGGGGAGCAAACAGG$
>CTC14_16471|M00842:336:000000000-C7WWK:1:1107:6941:10486:0:66|o:97|mo:0.000000|MR:n=0;r1=0;r2=0|Q30:p=77;p=70|CO:0| TGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCATGAGTGAAGAAGGCCTTTGGGTTGTAAAGCTCTTTTAGTGAGGAAGATAATGGCGGTACTCACAGAAGAAGTCCTGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGAGGGCTAGCGTTATTCGGAATTATTGGGCGTAAAGGGCGCGTAGGCTGGTTAATAAGTTAAAAGTGAAATCCCGAGGCTTAACCTTGGAATTGCTTTTAAAGCTATTAATCTAGAGATTGAAAGAGGATAGAGGAATTCCTGATGTAGAGGTAAAATTCGTGAATATTAGGAGGAACACCAGTGGCGAAGGCGTCTATCTGGTTCAAATCTGACGCTGAAGCGCGAAGGCGTGGGGAGCAAACAGG$
Assuming that >CTC14_18758|M00842:336:000000000- is on a separate line, this code will convert the input to the output.
#!/bin/sed -f
#skip blank lines
/^[[:space:]]*$/n
#change >CTC14_18758|M00842:336:000000000-
# to >Sample-CTC14_Read18758
s/^>/>Sample-/
s/_/_Read/
/^>/s/|.*$//
# remove 2ndary header
# C7WWK:1:1108:17474:5670:0:66|o:98|mo:0.000000|MR:n=0;r1=0;r2=0|Q30:p=66;p=62|CO:0| TGGGGAATATTGGAC...
# to
# TGGGGAATATTGGAC...
s/^[^>].*| //
Save that as a file/script.
Then mark it as executable with
chmod +x mySed
and run it like
./mySed -i fileIn
Or if you get an warning/error message about -i, then run
./mySed fileIn > fileOut && mv fileOut fileIn
Now you can eliminate your function header(), and the 2ndary loop in your code.
Just
for file in *.fasta ; do
echo "processing file=$file"
/path/to/mySed -i "$file"
# run other processing if needed
# don't think you need wait any more
#uncomment? wait
done
-------------- version 2 sed ---------------
#!/bin/sed -f
#skip blank lines
/^[[:space:]]*$/n
#>CTC14_18758|M00842:336:000000000-C7WWK:1:1108:17474:5670:0:66|o:98|mo:0.000000|MR:n=0;r1=0;r2=0|Q30:p=66;p=62|CO:0| TGGGGA...
#change >CTC14_18758|M00842:336:000000000-
# to >Sample-CTC14_Read18758
s/^>/>Sample-/
s/_/_Read/
s/|.*| / /
# /^>/s/-.*| / /
# s/-.*| / /
works with data like
>CTC14_16471|M00842:336:000000000-C7WWK:1:1107:6941:10486:0:66|o:97|mo:0.000000|MR:n=0;r1=0;r2=0|Q30:p=77;p=70|CO:0| TGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCATGAGTGAAGAAGGCCTTTGGGTTGTAAAGCTCTTTTAGTGAGGAAGATAATGGCGGTACTCACAGAAGAAGTCCTGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGAGGGCTAGCGTTATTCGGAATTATTGGGCGTAAAGGGCGCGTAGGCTGGTTAATAAGTTAAAAGTGAAATCCCGAGGCTTAACCTTGGAATTGCTTTTAAAGCTATTAATCTAGAGATTGAAAGAGGATAGAGGAATTCCTGATGTAGAGGTAAAATTCGTGAATATTAGGAGGAACACCAGTGGCGAAGGCGTCTATCTGGTTCAAATCTGACGCTGAAGCGCGAAGGCGTGGGGAGCAAACAGG
IHTH
I have file with a few lines:
x 1
y 2
z 3 t
I need to pass each line as paramater to some program:
$ program "x 1" "y 2" "z 3 t"
I know how to do it with two commands:
$ readarray -t a < file
$ program "${a[#]}"
How can i do it with one command? Something like that:
$ program ??? file ???
The (default) options of your readarray command indicate that your file items are separated by newlines.
So in order to achieve what you want in one command, you can take advantage of the special IFS variable to use word splitting w.r.t. newlines (see e.g. this doc) and call your program with a non-quoted command substitution:
IFS=$'\n'; program $(cat file)
As suggested by #CharlesDuffy:
you may want to disable globbing by running beforehand set -f, and if you want to keep these modifications local, you can enclose the whole in a subshell:
( set -f; IFS=$'\n'; program $(cat file) )
to avoid the performance penalty of the parens and of the /bin/cat process, you can write instead:
( set -f; IFS=$'\n'; exec program $(<file) )
where $(<file) is a Bash equivalent to to $(cat file) (faster as it doesn't require forking /bin/cat), and exec consumes the subshell created by the parens.
However, note that the exec trick won't work and should be removed if program is not a real program in the PATH (that is, you'll get exec: program: not found if program is just a function defined in your script).
Passing a set of params should be more organized :
In this example case I'm looking for a file containing chk_disk_issue=something etc.. so I set the values by reading a config file which I pass in as a param.
# -- read specific variables from the config file (if found) --
if [ -f "${file}" ] ;then
while IFS= read -r line ;do
if ! [[ $line = *"#"* ]]; then
var="$(echo $line | cut -d'=' -f1)"
case "$var" in
chk_disk_issue)
chk_disk_issue="$(echo $line | tr -d '[:space:]' | cut -d'=' -f2 | sed 's/[^0-9]*//g')"
;;
chk_mem_issue)
chk_mem_issue="$(echo $line | tr -d '[:space:]' | cut -d'=' -f2 | sed 's/[^0-9]*//g')"
;;
chk_cpu_issue)
chk_cpu_issue="$(echo $line | tr -d '[:space:]' | cut -d'=' -f2 | sed 's/[^0-9]*//g')"
;;
esac
fi
done < "${file}"
fi
if these are not params then find a way for your script to read them as data inside of the script and pass in the file name.
I am trying to run this command:
./smstocurl SLASH2.911325850268888.911325850268896
smstocurl script:
#SLASH2.911325850268888.911325850268896
model=$(echo \&model=$1 | cut -d'.' -f 1)
echo $model
imea1=$(echo \&simImea1=$1 | cut -d'.' -f 2)
echo $imea1
imea2=$(echo \&simImea2=$1 | cut -d'.' -f 3)
echo $imea2
echo $model$imea1$imea2
Result Received
&model=SLASH2911325850268888911325850268896
Result Expected
&model=SLASH2&simImea1=911325850268888&simImea2=911325850268896
What am I missing here ?
You are cutting based on the dot .. In the first case your desired string contains the first string, the one containing &model, so then it is printed.
However, in the other cases you get the 2nd and 3rd blocks (-f2, -f3), so that the imea text gets cutted off.
Instead, I would use something like this:
while IFS="." read -r model imea1 imea2
do
printf "&model=%s&simImea1=%s&simImea2=%s\n" $model $imea1 $imea2
done <<< "$1"
Note the usage of printf and variables to have more control about what we are writing. Using a lot of escapes like in your echos can be risky.
Test
while IFS="." read -r model imea1 imea2; do printf "&model=%s&simImea1=%s&simImea2=%s\n" $model $imea1 $imea2
done <<< "SLASH2.911325850268888.911325850268896"
Returns:
&model=SLASH2&simImea1=911325850268888&simImea2=911325850268896
Alternatively, this sed makes it:
sed -r 's/^([^.]*)\.([^.]*)\.([^.]*)$/\&model=\1\&simImea1=\2\&simImea2=\3/' <<< "$1"
by catching each block of words separated by dots and printing back.
You can also use this way
Run:
./program SLASH2.911325850268888.911325850268896
Script:
#!/bin/bash
String=`echo $1 | sed "s/\./\&simImea1=/"`
String=`echo $String | sed "s/\./\&simImea2=/"`
echo "&model=$String
Output:
&model=SLASH2&simImea1=911325850268888&simImea2=911325850268896
awk way
awk -F. '{print "&model="$1"&simImea1="$2"&simImea2="$3}' <<< "SLASH2.911325850268888.911325850268896"
or
awk -F. '$0="&model="$1"&simImea1="$2"&simImea2="$3' <<< "SLASH2.911325850268888.911325850268896"
output
&model=SLASH2&simImea1=911325850268888&simImea2=911325850268896
I want to create an array from a list of words. so, i'm using this code:
for i in {1..$count}
do
array[$i]=$(cat file.txt | cut -d',' -f3 | sort -r | uniq | tail -n ${i})
done
but it fails... in tail -n ${i}
I already tried tail -n $i, tail -n $(i) but can't pass tail the value of i
Any ideas?
It fails because you cannot use a variable in range directive in shell i.e. {1..10} is fine but {1..$n} is not.
While using BASH you can use ((...)) operators:
for ((i=1; i<=count; i++)); do
array[$i]=$(cut -d',' -f3 file.txt | sort -r | uniq | tail -n $i)
done
Also note removal of useless use of cat from your command.
Your range is not evaluated the way you are thinking, e.g.:
$ x=10
$ echo {1..$x}
{1..10}
You're better off just using a for loop:
for ((i = 1; i <= count; i++))
do
# ...
done
Just to elaborate on previous answers, this occurs because the 'brace expansion' is the first part of bash's parsing, and never gets repeated: when the braces are expanded, the '$count' is just a piece of text and so the braces are left as is. Then, when '$count' is expanded to a number, the brace expansion never runs again. See here.
If you wanted for some reason to force this brace expansion to happen again, you can use 'eval':
replace the {1..$count} with $(eval echo {1..${count}})
Better, in your case, to do as anubhava suggests.
Instead of reading the file numerous times, use the built-in mapfile command:
mapfile -t array < <(cut -d, -f3 file.txt | sort -r | uniq)
We are having a wierd issue.
We have this lines :
while read line2; do
echo $line2
done < $1 | `echo grep '.*|.*|.*|.*|.*|.*|.*|.*'` | sort -nbsk1 | cut -d "|" -f1 | uniq -d
Which prints what they should print. but, when changing the echo to ->
while read line2; do
echo "Hello World"
done < $1 | `echo grep '.*|.*|.*|.*|.*|.*|.*|.*'` | sort -nbsk1 | cut -d "|" -f1 | uniq -d
It wont print anything, same result for anything different then $line2.
Whats even more wierd is :
echo " $line2 Hello"
Will print the line2 variable
echo "Hello $line2"
Print nothing
I have tried the same with printf, same results.
Any suggestions ?
What you've written is equivalent to the following shell code:
cat $1 |
while read line2; do
echo $line2
done |
`echo grep '.*|.*|.*|.*|.*|.*|.*|.*'` |
sort -nbsk1 |
cut -d "|" -f1 |
uniq -d
The while read loop takes the contents of file $1 and echoes them, which does nothing other than remove leading and trailing spaces and replace internal spaces with a single space. If you replace the echo $line2 line with echo "Hello World", that string is clearly not going to match the grep command that the output of the loop is being passed through, so producing no output is unsurprising.
When you change the echo line to echo " $line2 Hello", you tack "Hello" onto the end of the input line, which then matches the grep command and gets sliced off the end of the string with the cut command, so it makes sense that it would have essentially no ultimate effect.
If you change the echo line to echo "Hello $line2", any number at the beginning of the line becomes invisible to the sort -ns, which makes your sort call essentially a no-op. This is probably why you're not seeing anything in this situation, although you probably would see something if two identical lines appeared in the input one after the other. (In my testing on my machine, I see one such line because I happen to have two identical lines in succession in my test case.)
It's not exactly clear what you're trying to do since the while loop is almost a no-op. It's possible what you want to do is something more like this:
grep '.*|.*|.*|.*|.*|.*|.*|.*' < $1 |
sort -nbsk1 |
cut -d "|" -f1 |
uniq -d |
while read line2; do
echo $line2
done
... but I'm only speculating at this point.