Splitting large text file on every blank line - bash
I'm having a bit trouble of splitting a large text file into multiple smaller ones. Syntax of my text file is the following:
dasdas #42319 blaablaa 50 50
content content
more content
content conclusion
asdasd #92012 blaablaa 30 70
content again
more of it
content conclusion
asdasd #299 yadayada 60 40
content
content
contend done
...and so on
A typical information table in my file has anywhere between 10-40 rows.
I would like this file to be split in n smaller files, where n is the amount of content tables.
That is
dasdas #42319 blaablaa 50 50
content content
more content
content conclusion
would be its own separate file, (whateverN.txt)
and
asdasd #92012 blaablaa 30 70
content again
more of it
content conclusion
again a separate file whateverN+1.txt and so forth.
It seems like awk or Perl are nifty tools for this, but having never used them before the syntax is kinda baffling.
I found these two questions that are almost correspondent to my problem, but failed to modify the syntax to fit my needs:
Split text file into multiple files & How can I split a text file into multiple text files? (on Unix & Linux)
How should one modify the command line inputs, so that it solves my problem?
Setting RS to null tells awk to use one or more blank lines as the record separator. Then you can simply use NR to set the name of the file corresponding to each new record:
awk -v RS= '{print > ("whatever-" NR ".txt")}' file.txt
RS:
This is awk's input record separator. Its default value is a string containing a single newline character, which means that an input record consists of a single line of text. It can also be the null string, in which case records are separated by runs of blank lines, or a regexp, in which case records are separated by matches of the regexp in the input text.
$ cat file.txt
dasdas #42319 blaablaa 50 50
content content
more content
content conclusion
asdasd #92012 blaablaa 30 70
content again
more of it
content conclusion
asdasd #299 yadayada 60 40
content
content
contend done
$ awk -v RS= '{print > ("whatever-" NR ".txt")}' file.txt
$ ls whatever-*.txt
whatever-1.txt whatever-2.txt whatever-3.txt
$ cat whatever-1.txt
dasdas #42319 blaablaa 50 50
content content
more content
content conclusion
$ cat whatever-2.txt
asdasd #92012 blaablaa 30 70
content again
more of it
content conclusion
$ cat whatever-3.txt
asdasd #299 yadayada 60 40
content
content
contend done
$
You could use the csplit command:
csplit \
--quiet \
--prefix=whatever \
--suffix-format=%02d.txt \
--suppress-matched \
infile.txt /^$/ {*}
POSIX csplit only uses short options and doesn't know --suffix and --suppress-matched, so this requires GNU csplit.
This is what the options do:
--quiet – suppress output of file sizes
--prefix=whatever – use whatever instead fo the default xx filename prefix
--suffix-format=%02d.txt – append .txt to the default two digit suffix
--suppress-matched – don't include the lines matching the pattern on which the input is split
/^$/ {*} – split on pattern "empty line" (/^$/) as often as possible ({*})
Perl has a useful feature called the input record separator. $/.
This is the 'marker' for separating records when reading a file.
So:
#!/usr/bin/env perl
use strict;
use warnings;
local $/ = "\n\n";
my $count = 0;
while ( my $chunk = <> ) {
open ( my $output, '>', "filename_".$count++ ) or die $!;
print {$output} $chunk;
close ( $output );
}
Just like that. The <> is the 'magic' filehandle, in that it reads piped data or from files specified on command line (opens them and reads them). This is similar to how sed or grep work.
This can be reduced to a one liner:
perl -00 -pe 'open ( $out, '>', "filename_".++$n ); select $out;' yourfilename_here
You can use this awk,
awk 'BEGIN{file="content"++i".txt"} !NF{file="content"++i".txt";next} {print > file}' yourfile
(OR)
awk 'BEGIN{i++} !NF{++i;next} {print > "filename"i".txt"}' yourfile
More readable format:
BEGIN {
file="content"++i".txt"
}
!NF {
file="content"++i".txt";
next
}
{
print > file
}
In case you get "too many open files" error as follows...
awk: whatever-18.txt makes too many open files
input record number 18, file file.txt
source line number 1
You may need to close newly created file, before creating a new one, as follows.
awk -v RS= '{close("whatever-" i ".txt"); i++}{print > ("whatever-" i ".txt")}' file.txt
Since it's Friday and I'm feeling a bit helpful... :)
Try this. If the file is as small as you imply it's simplest to just read it all at once and work in memory.
use strict;
use warnings;
# slurp file
local $/ = undef;
open my $fh, '<', 'test.txt' or die $!;
my $text = <$fh>;
close $fh;
# split on double new line
my #chunks = split(/\n\n/, $text);
# make new files from chunks
my $count = 1;
for my $chunk (#chunks) {
open my $ofh, '>', "whatever$count.txt" or die $!;
print $ofh $chunk, "\n";
close $ofh;
$count++;
}
The perl docs can explain any individual commands you don't understand but at this point you should probably look into a tutorial as well.
awk -v RS="\n\n" '{for (i=1;i<=NR;i++); print > i-1}' file.txt
Sets record separator as blank line, prints each record as a separate file numbered 1, 2, 3, etc. Last file (only) ends in blank line.
Try this bash script also
#!/bin/bash
i=1
fileName="OutputFile_$i"
while read line ; do
if [ "$line" == "" ] ; then
((++i))
fileName="OutputFile_$i"
else
echo $line >> "$fileName"
fi
done < InputFile.txt
You can also try split -p "^$"
Related
Grep list (file) from another file
Im new to bash and trying to extract a list of patterns from file: File1.txt ABC BDF GHJ base.csv (tried comma separated and tab delimited) line 1,,,,"hfhf,ferf,ju,ABC" line 2 ,,,,,"ewy,trggt,gtg,ABC,RFR" line 3 .."himk,n,hn.ujj., BDF" etc Suggested output is smth like ABC line 1.. line 2..(whole lines) BDF line 3.. and so on for each pattern from file 1 the code i tried was: #!/bin/bash for i in *.txt -# cycle through all files containing pattern lists do for q in "$i"; # # cycle through list do echo $q >>output.${i}; grep -f "${q}" base.csv >>output.${i}; echo "\n"; done done But output is only filename and then some list of strings without pattern names, e.g. File1.txt line 1... line 2... line 3.. so i don`t know to what pattern belongs each string and have to check and assign manually. Can you please point out my errors? Thanks!
grep can process multiple files in one go, and then has the attractive added bonus of indicating which file it found a match in. grep -f File1.txt base.csv >output.txt It's not clear what you hope for the inner loop to do; it will just loop over a single token at a time, so it's not really a loop at all. If you want the output to be grouped per pattern, here's a for loop which looks for one pattern at a time: while read -r pat; do echo "$pat" grep "$pat" *.txt done <File1.txt >output.txt But the most efficient way to tackle this is to write a simple Awk script which processes all the input files at once, and groups the matches before printing them. An additional concern is anchoring. grep "ABC" will find a match in 123DEABCXYZ; is this something you want to avoid? You can improve the regex, or, again, turn to Awk which gives you more control over where exactly to look for a match in a structured line. awk '# Read patterns into memory NR==FNR { a[++i] = $1; next } # Loop across patterns { for(j=1; j<=i; ++j) if($0 ~ a[j]) { print FILENAME ":" FNR ":" $0 >>output.a[j] next } }' File1.txt base.csv
You're not actually reading the files, you're just handling the filenames. Try this: #!/bin/bash for i in *.txt # cycle through all files containing pattern lists do while read -r q # read file line by line do echo "$q" >>"output.${i}" grep -f "${q}" base.csv >>"output.${i}" echo "\n" done < "${i}" done
Here is one that separates (with split, comma-separatd with quotes and spaces stripped off) words from file2 to an array (word[]) and stores the record names (line 1 etc.) to it comma-separated: awk ' NR==FNR { n=split($0,tmp,/[" ]*(,|$)[" ]*/) # split words for(i=2;i<=n;i++) # after first if(tmp[i]!="") # non-empties word[tmp[i]]=word[tmp[i]] (word[tmp[i]]==""?"":",") tmp[1] # hash rownames record[tmp[1]]=$0 # store records next } ($1 in word) { # word found n=split(word[$1],tmp,",") # get record names print $1 ":" # output word for(i=1;i<=n;i++) # and records print record[tmp[i]] }' file2 file1 Output: ABC: line 1,,,,"hfhf,ferf,ju,ABC" line 2 ,,,,,"ewy,trggt,gtg,ABC,RFR" BDF: line 3 .."himk,n,hn.ujj., BDF"
Thank you for your kind help, my friends. Tried both variants above but kept getting various errors ( "do" expected) or misbehavior ( gets names of pattern blocks, eg ABC, BDF, but no lines. Gave up for a while and then eventually tried another way While base goal were to cycle through pattern list files, search for patterns in huge file and write out specific columns from lines found - i simply wrote for *i in *txt # cycle throughfiles w/ patterns do grep -F -f "$i" bigfile.csv >> ${i}.out1 #greps all patterns from current file cut -f 2,3,4,7 ${i}.out1>> ${i}.out2 # cuts columns of interest and writes them out to another file done I'm aware that this code should be improved using some fancy pipeline features, but it works perfectly as is, hope it`ll help somebody in similar situation. You can easily add some echoes to write out pattern list names as i initially requested
Replace some lines in fasta file with appended text using while loop and if/else statement
I am working with a fasta file and need to add line-specific text to each of the headers. So for example if my file is: >TER1 AGCATGCTAGCTAGTCGACTCGATCGCATGCTC >TER2 AGCATGCTAGCTAGACGACTCGATCGCATGCTC >URC1 AGCATGCTAGCTAGTCGACTCGATCGCATGCTC >URC2 AGCATGCTACCTAGTCGACTCGATCGCATGCTC >UCR3 AGCATGCTAGCTAGTCGACTCGATGGCATGCTC I want a while loop that will read through each line; for those with a > at the start, I want to append |population: plus the first three characters after the >. So line one would be: >TER1|population:TER etc. I can't figure out how to make this work. Here my best attempt so far. filename="testfasta.fa" while read -r line do if [[ "$line" == ">"* ]]; then id=$(cut -c2-4<<<"$line") printf $line"|population:"$id"\n" >>outfile else printf $line"\n">>outfile fi done <"$filename" This produces a file with the original headers and following line each on a single line. Can someone tell me where I'm going wrong? My if and else loop aren't working at all! Thanks!
You could use a while loop if you really want, but sed would be simpler: sed -e 's/^>\(...\).*/&|population:\1/' "$filename" That is, for lines starting with > (pattern: ^>), capture the next 3 characters (with \(...\)), and match the rest of the line (.*), replace with the line as it was (&), and the fixed string |population:, and finally the captured 3 characters (\1). This will produce for your input: >TER1|population:TER AGCATGCTAGCTAGTCGACTCGATCGCATGCTC >TER2|population:TER AGCATGCTAGCTAGACGACTCGATCGCATGCTC >URC1|population:URC AGCATGCTAGCTAGTCGACTCGATCGCATGCTC >URC2|population:URC AGCATGCTACCTAGTCGACTCGATCGCATGCTC >UCR3|population:UCR AGCATGCTAGCTAGTCGACTCGATGGCATGCTC Or you can use this awk, also producing the same output: awk '{sub(/^>.*/, $0 "|population:" substr($0, 2, 3))}1' "$filename"
You can do this quickly in awk: awk '$1~/^>/{$1=$1"|population:"substr($1,2,3)}{}1' infile.txt > outfile.txt $ awk '$1~/^>/{$1=$1"|population:"substr($1,2,3)}{}1' testfile >TER1|population:TER AGCATGCTAGCTAGTCGACTCGATCGCATGCTC >TER2|population:TER AGCATGCTAGCTAGACGACTCGATCGCATGCTC >URC1|population:URC AGCATGCTAGCTAGTCGACTCGATCGCATGCTC >URC2|population:URC AGCATGCTACCTAGTCGACTCGATCGCATGCTC >UCR3|population:UCR AGCATGCTAGCTAGTCGACTCGATGGCATGCTC Here awk will: Test if the record starts with a > The $1 looks at the first field, but $0 for the entire record would work just as well in this case. The ~ will perform a regex test, and ^> means "Starts with >". Making the test: ($1~/^>/) If so it will set the first field to the output you are looking for (using substr() to get the bits of the string you want. {$1=$1"|population:"substr($1,2,3)} Finally it will print out the entire record (with the changes if applicable): {}1 which is shorthand for {print $0} or.. print the entire record.
use grep and awk to transfer data from .srt to .csv/xls
I got an interesting project to do! I'm thinking about converting an srt file into a csv/xls file. a srt file would look like this: 1 00:00:00,104 --> 00:00:02,669 Hi, I'm shell-scripting. 2 00:00:02,982 --> 00:00:04,965 I'm not sure if it would work, but I'll try it! 3 00:00:05,085 --> 00:00:07,321 There must be a way to do it! while I want to output it into a csv file like this: "1","00:00:00,104","00:00:02,669","Hi, I'm shell-scripting." "2","00:00:02,982","00:00:04,965","I'm not sure if it would work" ,,,"but I'll try it!" "3","00:00:05,085","00:00:07,321","There must be a way to do it!" So as you can see, each subtitle takes up two rows. My thinking would be using grep to put the srt data into the xls, and then use awk to format the xls file. What do you guys think? How am I suppose to write it? I tried $grep filename.srt > filename.xls It seems that all the data including the time codes and the subtitle words ended up all in column A of the xls file...but I want the words to be in column B...How would awk be able to help with the formatting? Thank you in advance! :)
$ cat tst.awk BEGIN { RS=""; FS="\n"; OFS=","; q="\""; s=q OFS q } { split($2,a,/ .* /) print q $1 s a[1] s a[2] s $3 q for (i=4;i<=NF;i++) { print "", "", "", q $i q } } $ awk -f tst.awk file "1","00:00:00,104","00:00:02,669","Hi, I'm shell-scripting." "2","00:00:02,982","00:00:04,965","I'm not sure if it would work," ,,,"but I'll try it!" "3","00:00:05,085","00:00:07,321","There must be a way to do it!"
I think something like this should do it quite nicely: awk -v RS= -F'\n' ' { sub(" --> ","\x7c",$2) # change "-->" to "|" printf "%s|%s|%s\n",$1,$2,$3 # print scene, time start, time stop, description for(i=4;i<=NF;i++)printf "|||%s\n",$i # print remaining lines of description }' file.srt The -v RS= sets the Record Separator to blank lines. The -F'\n' sets the Field Separator to new lines. The sub() replaces the "-->" with a pipe symbol (|). The first three fields are then printed separated by pipes, and then there is a little loop to print the remaining lines of description, inset by three pipe symbols to make them line up. Output 1|00:00:00,104|00:00:02,669|Hi, I'm shell-scripting. 2|00:00:02,982|00:00:04,965|I'm not sure if it would work, |||but I'll try it! 3|00:00:05,085|00:00:07,321|There must be a way to do it! As I am feeling like having some more fun with Perl and Excel, I took the above output and parsed it in Perl and wrote a real Excel XLSX file. Of course, there is no real need to use awk and Perl so ideally one would re-cast the awk and integrate it into the Perl since the latter can write Excel files while the former cannot. Anyway here is the Perl. #!/usr/bin/perl use strict; use warnings; use Excel::Writer::XLSX; my $DEBUG=0; my $workbook = Excel::Writer::XLSX->new('result.xlsx'); my $worksheet = $workbook->add_worksheet(); my $row=0; while(my $line=<>){ $row++; # move down a line in Excel worksheet chomp $line; # strip CR my #f=split /\|/, $line; # split fields of line into array #f[], on pipe symbols (|) for(my $j=0;$j<scalar #f;$j++){ # loop through all fields my $cell= chr(65+$j) . $row; # calcuate Excell cell, starting at A1 (65="A") $worksheet->write($cell,$f[$j]); # write to spreadsheet printf "%s:%s ",$cell,$f[$j] if $DEBUG; } printf "\n" if $DEBUG; } $workbook->close; Output
My other answer was half awk and half Perl, but, given that awk can't write Excel spreadsheets whereas Perl can, it seems daft to require you to master both awk and Perl when Perl is perfectly capable of doing it all on its own... so here goes in Perl: #!/usr/bin/perl use strict; use warnings; use Excel::Writer::XLSX; my $workbook = Excel::Writer::XLSX->new('result.xlsx'); my $worksheet = $workbook->add_worksheet(); my $ExcelRow=0; local $/ = ""; # set paragraph mode, so we read till next blank line as one record while(my $para=<>){ $ExcelRow++; # move down a line in Excel worksheet chomp $para; # strip CR my #lines=split /\n/, $para; # split paragraph into lines on linefeed character my $scene = $lines[0]; # pick up scene number from first line of para my ($start,$end)=split / --> /,$lines[1]; # pick up start and end time from second line my $cell=sprintf("A%d",$ExcelRow); # work out cell $worksheet->write($cell,$scene); # write scene to spreadsheet column A $cell=sprintf("B%d",$ExcelRow); # work out cell $worksheet->write($cell,$start); # write start time to spreadsheet column B $cell=sprintf("C%d",$ExcelRow); # work out cell $worksheet->write($cell,$end); # write end time to spreadsheet column C $cell=sprintf("D%d",$ExcelRow); # work out cell $worksheet->write($cell,$lines[2]); # write description to spreadsheet column D for(my $i=3;$i<scalar #lines;$i++){ # output additional lines of description $ExcelRow++; $cell=sprintf("D%d",$ExcelRow); # work out cell $worksheet->write($cell,$lines[$i]); } } $workbook->close; Save the above on a file called srt2xls and then make it executable with the command: chmod +x srt2xls Then you can run it with ./srt2xls < SomeFileile.srt and it will give you this spreadsheet called result.xlsx
Since you want to convert the srt into csv. below is awk command awk '{gsub(" --> ","\x22,\x22");if(NF!=0){if(j<3)k=k"\x22"$0"\x22,";else{k="\x22"$0"\x22 ";l=1}j=j+1}else j=0;if(j==3){print k;k=""}if(l==1){print ",,,"k ;l=0;k=""}}' inputfile > output.csv detail veiw of awk awk '{ gsub(" --> ","\x22,\x22"); if(NF!=0) { if(j<3) k=k"\x22"$0"\x22,"; else { k="\x22"$0"\x22 "; l=1 } j=j+1 } else j=0; if(j==3) { print k; k="" } if(l==1) { print ",,,"k; l=0; k="" } }' inputfile > output.csv take the output.csv on windows platform and then open with microsoft excel and save it as .xls extension.
How to convert HHMMSS to HH:MM:SS Unix?
I tried to convert the HHMMSS to HH:MM:SS and I am able to convert it successfully but my script takes 2 hours to complete because of the file size. Is there any better way (fastest way) to complete this task Data File data.txt 10,SRI,AA,20091210,8503,ABCXYZ,D,N,TMP,,, 10,SRI,AA,20091210,8503,ABCXYZ,D,N,TMP,,071600, 10,SRI,AA,20091210,8503,ABCXYZ,D,N,TMP,072200,072200, 10,SRI,AA,20091210,8503,ABCXYZ,D,N,TAB,072600,072600, 10,SRI,AA,20091210,8503,ABCXYZ,D,N,TMP,073200,073200, 10,SRI,AA,20091210,8503,ABCXYZ,D,N,TMP,073500,073500, 10,SRI,AA,20091210,8503,ABCXYZ,D,N,MRO,073700,073700, 10,SRI,AA,20091210,8503,ABCXYZ,D,N,CPT,073900,073900, 10,SRI,AA,20091210,8503,ABCXYZ,D,N,TMP,074400,, 10,SRI,AA,20091210,8505,ABCXYZ,D,N,TMP,,, 10,SRI,AA,20091210,8505,ABCXYZ,D,N,TMP,,090200, 10,SRI,AA,20091210,8505,ABCXYZ,D,N,TMP,090900,090900, 10,SRI,AA,20091210,8505,ABCXYZ,D,N,TMP,091500,091500, 10,SRI,AA,20091210,8505,ABCXYZ,D,N,TAB,091900,091900, 10,SRI,AA,20091210,8505,ABCXYZ,D,N,TMP,092500,092500, 10,SRI,AA,20091210,8505,ABCXYZ,D,N,TMP,092900,092900, 10,SRI,AA,20091210,8505,ABCXYZ,D,N,MRO,093200,093200, 10,SRI,AA,20091210,8505,ABCXYZ,D,N,CPT,093500,093500, 10,SRI,AA,20091210,8505,ABCXYZ,D,N,TMP,094500,, 10,SRI,AA,20091210,8506,ABCXYZ,U,N,TMP,,, 10,SRI,AA,20091210,8506,ABCXYZ,U,N,CPT,,, 10,SRI,AA,20091210,8506,ABCXYZ,U,N,MRO,,, 10,SRI,AA,20091210,8506,ABCXYZ,U,N,TMP,,, 10,SRI,AA,20091210,8506,ABCXYZ,U,N,TMP,,, 10,SRI,AA,20091210,8506,ABCXYZ,U,N,TAB,,, 10,SRI,AA,20091210,8506,ABCXYZ,U,N,TMP,,, 10,SRI,AA,20091210,8506,ABCXYZ,U,N,TMP,,, 10,SRI,AA,20091210,8506,ABCXYZ,U,N,TMP,,, 10,SRI,AA,20091210,8506,ABCXYZ,U,N,TMP,,, 10,SRI,AA,20091210,8510,ABCXYZ,U,N,TMP,,170100, 10,SRI,AA,20091210,8510,ABCXYZ,U,N,CPT,170400,170400, 10,SRI,AA,20091210,8510,ABCXYZ,U,N,MRO,170700,170700, 10,SRI,AA,20091210,8510,ABCXYZ,U,N,TMP,171000,171000, 10,SRI,AA,20091210,8510,ABCXYZ,U,N,TMP,171500,171500, 10,SRI,AA,20091210,8510,ABCXYZ,U,N,TAB,171900,171900, 10,SRI,AA,20091210,8510,ABCXYZ,U,N,TMP,172500,172500, 10,SRI,AA,20091210,8510,ABCXYZ,U,N,TMP,172900,172900, 10,SRI,AA,20091210,8510,ABCXYZ,U,N,TMP,173500,173500, 10,SRI,AA,20091210,8510,ABCXYZ,U,N,TMP,174100,, My code : script.sh #!/bin/bash awk -F"," '{print $5}' Data.txt > tmp.txt # print first line first string before , to tmp.txt i.e. all Numbers will be placed into tmp.txt sort tmp.txt | uniq -d > Uniqe_number.txt # unique values be stored to Uniqe_number.txt rm tmp.txt # removes tmp file while read line; do echo $line cat Data.txt | grep ",$line," > Numbers/All/$line.txt # grep Number and creats files induvidtually awk -F"," '{print $5","$4","$7","$8","$9","$10","$11}' Numbers/All/$line.txt > Numbers/All/tmp_$line.txt mv Numbers/All/tmp_$line.txt Numbers/Final/Final_$line.txt done < Uniqe_number.txt ls Numbers/Final > files.txt dos2unix files.txt bash time_replace.sh when you execute above script it will call time_replace.sh script My Code for time_replace.sh #!/bin/bash for i in `cat files.txt` do while read aline do TimeDep=`echo $aline | awk -F"," '{print $6}'` #echo $TimeDep finalTimeDep=`echo $TimeDep | awk '{for(i=1;i<=length($0);i+=2){printf("%s:",substr($0,i,2))}}'|awk '{sub(/:$/,"")};1'` #echo $finalTimeDep ########## TimeAri=`echo $aline | awk -F"," '{print $7}'` #echo $TimeAri finalTimeAri=`echo $TimeAri | awk '{for(i=1;i<=length($0);i+=2){printf("%s:",substr($0,i,2))}}'|awk '{sub(/:$/,"")};1'` #echo $finalTimeAri sed -i 's/',$TimeDep'/',$finalTimeDep'/g' Numbers/Final/$i sed -i 's/',$TimeAri'/',$finalTimeAri'/g' Numbers/Final/$i ############################ done < Numbers/Final/$i done Any better solution? Appreciate any help. Thanks Sri
If there's a large quantity of files, then the pipelines are probably what are going to impact performance more than anything else - although processes can be cheap, if you're doing a huge amount of processing then cutting down the amount of time you do pass data through a pipeline can reap dividends. So you're probably going to be better off writing the entire script in awk (or perl). For example, awk can send output to an arbitary file, so the while lop in your first file could be replaced with an awk script that does this. You also don't need to use a temporary file. I assume the sorting is just for tracking progress easily as you know how many numbers there are. But if you don't care for the sorting, you can simply do this: #!/bin/sh awk -F ',' ' { print $5","$4","$7","$8","$9","$10","$11 > Numbers/Final/Final_$line.txt }' datafile.txt ls Numbers/Final > files.txt Alternatively, if you need to sort you can do sort -t, -k5,4,10 (or whichever field your sort keys actually need to be). As for formatting the datetime, awk also does functions, so you could actually have an awk script that looks like this. This would replace both of your scripts above whilst retaining the same functionality (at least, as far as I can make out with a quick analysis) ... (Note! Untested, so may contain vauge syntax errors): #!/usr/bin/awk BEGIN { FS="," } function formattime (t) { return substr(t,1,2)":"substr(t,3,2)":"substr(t,5,2) } { print $5","$4","$7","$8","$9","formattime($10)","formattime($11) > Numbers/Final/Final_$line.txt } which you can save, chmod 700, and call directly as: dostuff.awk filename Other awk options include changing fields in-situ, so if you want to maintain the entire original file but with formatted datetimes, you can do a modification of the above. Change the print block to: { $10=formattime($10) $11=formattime($11) print $0 } If this doesn't do everything you need it to, hopefully it gives some ideas that will help the code.
It's not clear what all your sorting and uniq-ing is for. I'm assuming your data file has only one entry per line, and you need to change the 10th and 11th comma-separated fields from HHMMSS to HH:MM:SS. while IFS=, read -a line ; do echo -n ${line[0]},${line[1]},${line[2]},${line[3]}, echo -n ${line[4]},${line[5]},${line[6]},${line[7]}, echo -n ${line[8]},${line[9]}, if [ -n "${line[10]}" ]; then echo -n ${line[10]:0:2}:${line[10]:2:2}:${line[10]:4:2} fi echo -n , if [ -n "${line[11]}" ]; then echo -n ${line[11]:0:2}:${line[11]:2:2}:${line[11]:4:2} fi echo "" done < data.txt The operative part is the ${variable:offset:length} construct that lets you extract substrings out of a variable.
In Perl, that's close to child's play: #!/usr/bin/env perl use strict; use warnings; use English( -no_match_vars ); local($OFS) = ","; while (<>) { my(#F) = split /,/; $F[9] =~ s/(\d\d)(\d\d)(\d\d)/$1:$2:$3/ if defined $F[9]; $F[10] =~ s/(\d\d)(\d\d)(\d\d)/$1:$2:$3/ if defined $F[10]; print #F; } If you don't want to use English, you can write local($,) = ","; instead; it controls the output field separator, choosing to use comma. The code reads each line in the file, splits it up on the commas, takes the last two fields, counting from zero, and (if they're not empty) inserts colons in between the pairs of digits. I'm sure a 'Code Golf' solution would be made a lot shorter, but this is semi-legible if you know any Perl. This will be quicker by far than the script, not least because it doesn't have to sort anything, but also because all the processing is done in a single process in a single pass through the file. Running multiple processes per line of input, as in your code, is a performance disaster when the files are big. The output on the sample data you gave is: 10,SRI,AA,20091210,8503,ABCXYZ,D,N,TMP,,, 10,SRI,AA,20091210,8503,ABCXYZ,D,N,TMP,,07:16:00, 10,SRI,AA,20091210,8503,ABCXYZ,D,N,TMP,07:22:00,07:22:00, 10,SRI,AA,20091210,8503,ABCXYZ,D,N,TAB,07:26:00,07:26:00, 10,SRI,AA,20091210,8503,ABCXYZ,D,N,TMP,07:32:00,07:32:00, 10,SRI,AA,20091210,8503,ABCXYZ,D,N,TMP,07:35:00,07:35:00, 10,SRI,AA,20091210,8503,ABCXYZ,D,N,MRO,07:37:00,07:37:00, 10,SRI,AA,20091210,8503,ABCXYZ,D,N,CPT,07:39:00,07:39:00, 10,SRI,AA,20091210,8503,ABCXYZ,D,N,TMP,07:44:00,, 10,SRI,AA,20091210,8505,ABCXYZ,D,N,TMP,,, 10,SRI,AA,20091210,8505,ABCXYZ,D,N,TMP,,09:02:00, 10,SRI,AA,20091210,8505,ABCXYZ,D,N,TMP,09:09:00,09:09:00, 10,SRI,AA,20091210,8505,ABCXYZ,D,N,TMP,09:15:00,09:15:00, 10,SRI,AA,20091210,8505,ABCXYZ,D,N,TAB,09:19:00,09:19:00, 10,SRI,AA,20091210,8505,ABCXYZ,D,N,TMP,09:25:00,09:25:00, 10,SRI,AA,20091210,8505,ABCXYZ,D,N,TMP,09:29:00,09:29:00, 10,SRI,AA,20091210,8505,ABCXYZ,D,N,MRO,09:32:00,09:32:00, 10,SRI,AA,20091210,8505,ABCXYZ,D,N,CPT,09:35:00,09:35:00, 10,SRI,AA,20091210,8505,ABCXYZ,D,N,TMP,09:45:00,, 10,SRI,AA,20091210,8506,ABCXYZ,U,N,TMP,,, 10,SRI,AA,20091210,8506,ABCXYZ,U,N,CPT,,, 10,SRI,AA,20091210,8506,ABCXYZ,U,N,MRO,,, 10,SRI,AA,20091210,8506,ABCXYZ,U,N,TMP,,, 10,SRI,AA,20091210,8506,ABCXYZ,U,N,TMP,,, 10,SRI,AA,20091210,8506,ABCXYZ,U,N,TAB,,, 10,SRI,AA,20091210,8506,ABCXYZ,U,N,TMP,,, 10,SRI,AA,20091210,8506,ABCXYZ,U,N,TMP,,, 10,SRI,AA,20091210,8506,ABCXYZ,U,N,TMP,,, 10,SRI,AA,20091210,8506,ABCXYZ,U,N,TMP,,, 10,SRI,AA,20091210,8510,ABCXYZ,U,N,TMP,,17:01:00, 10,SRI,AA,20091210,8510,ABCXYZ,U,N,CPT,17:04:00,17:04:00, 10,SRI,AA,20091210,8510,ABCXYZ,U,N,MRO,17:07:00,17:07:00, 10,SRI,AA,20091210,8510,ABCXYZ,U,N,TMP,17:10:00,17:10:00, 10,SRI,AA,20091210,8510,ABCXYZ,U,N,TMP,17:15:00,17:15:00, 10,SRI,AA,20091210,8510,ABCXYZ,U,N,TAB,17:19:00,17:19:00, 10,SRI,AA,20091210,8510,ABCXYZ,U,N,TMP,17:25:00,17:25:00, 10,SRI,AA,20091210,8510,ABCXYZ,U,N,TMP,17:29:00,17:29:00, 10,SRI,AA,20091210,8510,ABCXYZ,U,N,TMP,17:35:00,17:35:00, 10,SRI,AA,20091210,8510,ABCXYZ,U,N,TMP,17:41:00,,
search a pattern in file and output each pattern result in its own file using awk, sed
I have a file of numbers in each new line: $cat test 700320947 700509217 701113187 701435748 701435889 701667717 701668467 702119126 702306577 702914910 that I want to search details of from another larger file with several comma separated fields and out put results in 700320947.csv 700509217.csv 701113187.csv 701435748.csv 701435889.csv 701667717.csv 701668467.csv 702119126.csv 702306577.csv 702914910.csv Logic: ls test | while read file; do zgrep $line *large*file*gz >> $line.csv ; done Please assist. Thanks
Since nothing said about the structure of the large file, I'll just assume that the numbers in test are to be found in the second column of the large file; generalize as needed. This can be done in a single pass through each of the files by using output redirection in awk: awk -F"," 'FILENAME == "test" { num[$1]=1; next } num[$2] { print > $2".csv" }' test bigfile
Unzip the large file first; using zgrep means unzipping on-the-fly for every line of the number file... very inefficient. After unzipping the big file, this will do it: for number in `cat test`; do grep $number bigfile > $number.csv; done Edited: To limit hits to whole words only (eg 702119126 won't match 1702119126), add word boundaries to the regex: for number in `cat test`; do grep \\b$number\\b bigfile > $number.csv; done