#!/bin/bash
read k
read m
read fileName
head -n -$k $fileName | tail -n +$m $fileName
Hi, this is what I have now. I have to create bash interpreter that removes the lines from head and removes lines from tail in text file.
I have to excute this bash interpreter by this way.
./strip.sh 2 3 hi.txt > bye.txt
How do I read 2 for k and 3 for m?
Also how do I read hi.txt for fileName?
Also is my code correct?
Please answer these question. I am really new to this bash interpreter.
Thank you.
read is for reading values from standard input. What you want are positional parameters:
k=$1
m=$2
fileName=$3
head -n -$k "$fileName" | tail -n +$m
Drop the final argument of fileName from tail, because it will read from standard input (fed by the standard output of head), not a named file.
#chepner point you in the correct direction but the script as is at the moment does not work as you expected. If you want to try another approach:
#!/bin/bash
set -u
k=${1}
file=${3}
lines=$(wc -l < "${file}")
m=$[${lines}-${2}]
awk 'NR>'${k}' && NR<='${m} "${file}"
Where:
set -u: make undefined variables (such as missing params) stop the execution
$(wc -l < "${file}"): count the total lines of the file.
$[${lines}-${2}]: subtract from bottom lines desired (passed to remove from the total number of lines
awk 'NR>k && NR<=m': print (default awk behaviour) the lines > k and <= m
Related
I am trying go count the length of each read in a fastq file from illumina sequencing and outputting this to a tsv or any sort of file so I can then later also look at this and count the number of reads per file. So I need to cycle down the file and eactract each line that has a read on it (every 4th line) then get its length and store this as an output
num=2
for file in *.fastq
do
echo "counting $file"
function file_length(){
wc -l $file | awk '{print$FNR}'
}
for line in $file_length
do
awk 'NR==$num' $file | chrlen > ${file}read_length.tsv
num=$((num + 4))
done
done
Currently all I get the counting $file and no other output but also no errors
Your script contains a lot of errors in both syntax and algorithm. Please try shellcheck to see what is the problem. The most issue will be the $file_length part.
You may want to call a function file_length() here but it is just
an undefined variable which is evaluated as null in the for loop.
If you just want to count the length of the 4th line of *.fastq files,
please try something like:
for file in *.fastq; do
awk 'NR==4 {print length}' "$file" > "${file}_length.tsv"
done
Or if you want to put the results together in a single tsv file, try:
tsvfile="read_lenth.tsv"
for file in *.fastq; do
echo -n -e "$file\t" >> "$tsvfile"
awk 'NR==4 {print length}' "$file" >> "$tsvfile"
done
Hope this helps.
I am trying to write a script which takes a directory containing text files (384 of them) and modifies duplicate lines that have a specific format in order to make them not duplicates.
In particular, I have files in which some lines begin with the '#' character and contain the substring 0:0. A subset of these lines are duplicated one or more times. For those that are duplicated, I'd like to replace 0:0 with i:0 where i starts at 1 and is incremented.
So far I've written a bash script that finds duplicated lines beginning with '#', writes them to a file, then reads them back and uses sed in a while loop to search and replace the first occurrence of the line to be replaced. This is it below:
#!/bin/bash
fdir=$1"*"
#for each fastq file
for f in $fdir
do
(
#find duplicated read names and write to file $f.txt
sort $f | uniq -d | grep ^# > "$f".txt
#loop over each duplicated readname
while read in; do
rname=$in
i=1
#while this readname still exists in the file increment and replace
while grep -q "$rname" $f; do
replace=${rname/0:0/$i:0}
sed -i.bu "0,/$rname/s/$rname/$replace/" "$f"
let "i+=1"
done
done < "$f".txt
rm "$f".txt
rm "$f".bu
done
echo "done" >> progress.txt
)&
background=( $(jobs -p) )
if (( ${#background[#]} ==40)); then
wait -n
fi
done
The problem with it is that its impractically slow. I ran it on a 48 core computer for over 3 days and it hardly got through 30 files. It also seemed to have removed about 10 files and I'm not sure why.
My question is where are the bugs coming from and how can I do this more efficiently? I'm open to using other programming languages or changing my approach.
EDIT
Strangely the loop works fine on one file. Basically I ran
sort $f | uniq -d | grep ^# > "$f".txt
while read in; do
rname=$in
i=1
while grep -q "$rname" $f; do
replace=${rname/0:0/$i:0}
sed -i.bu "0,/$rname/s/$rname/$replace/" "$f"
let "i+=1"
done
done < "$f".txt
To give you an idea of what the files look like below are a few lines from one of them. The thing is that even though it works for the one file, it's slow. Like multiple hours for one file of 7.5 M. I'm wondering if there's a more practical approach.
With regard to the file deletions and other bugs I have no idea what was happening Maybe it was running into memory collisions or something when they were run in parallel?
Sample input:
#D00269:138:HJG2TADXX:2:1101:0:0 1:N:0:CCTAGAAT+ATTCCTCT
GATAAGGACGGCTGGTCCCTGTGGTACTCAGAGTATCGCTTCCCTGAAGA
+
CCCFFFFFHHFHHIIJJJJIIIJJIJIJIJJIIBFHIHIIJJJJJJIJIG
#D00269:138:HJG2TADXX:2:1101:0:0 1:N:0:CCTAGAAT+ATTCCTCT
CAAGTCGAACGGTAACAGGAAGAAGCTTGCTTCTTTGCTGACGAGTGGCG
Sample output:
#D00269:138:HJG2TADXX:2:1101:1:0 1:N:0:CCTAGAAT+ATTCCTCT
GATAAGGACGGCTGGTCCCTGTGGTACTCAGAGTATCGCTTCCCTGAAGA
+
CCCFFFFFHHFHHIIJJJJIIIJJIJIJIJJIIBFHIHIIJJJJJJIJIG
#D00269:138:HJG2TADXX:2:1101:2:0 1:N:0:CCTAGAAT+ATTCCTCT
CAAGTCGAACGGTAACAGGAAGAAGCTTGCTTCTTTGCTGACGAGTGGCG
Here's some code that produces the required output from your sample input.
Again, it is assumed that your input file is sorted by the first value (up to the first space character).
time awk '{
#dbg if (dbg) print "#dbg:prev=" prev
if (/^#/ && prev!=$1) {fixNum=0 ;if (dbg) print "prev!=$1=" prev "!=" $1}
if (/^#/ && (prev==$1 || NR==1) ) {
prev=$1
n=split($1,tmpArr,":") ; n++
#dbg if (dbg) print "tmpArr[6]="tmpArr[6] "\tfixNum="fixNum
fixNum++;tmpArr[6]=fixNum;
# magic to rebuild $1 here
for (i=1;i<n;i++) {
tmpFix ? tmpFix=tmpFix":"tmpArr[i]"" : tmpFix=tmpArr[i]
}
$1=tmpFix ; $0=$0
print $0
}
else { tmpFix=""; print $0 }
}' file > fixedFile
output
#D00269:138:HJG2TADXX:2:1101:1:0 1:N:0:CCTAGAAT+ATTCCTCT
GATAAGGACGGCTGGTCCCTGTGGTACTCAGAGTATCGCTTCCCTGAAGA
+
CCCFFFFFHHFHHIIJJJJIIIJJIJIJIJJIIBFHIHIIJJJJJJIJIG
#D00269:138:HJG2TADXX:2:1101:2:0 1:N:0:CCTAGAAT+ATTCCTCT
CAAGTCGAACGGTAACAGGAAGAAGCTTGCTTCTTTGCTGACGAGTGGCG
I've left a few of the #dbg:... statements in place (but they are now commented out) to show how you can run a small set of data as you have provided, and watch the values of variables change.
Assuming a non-csh, you should be able to copy/paste the code block into a terminal window cmd-line and replace file > fixFile at the end with your real file name and a new name for the fixed file. Recall that awk 'program' file > file (actually, any ...file>file) will truncate the existing file and then try to write, SO you can lose all the data of a file trying to use the same name.
There are probably some syntax improvements that will reduce the size of this code, and there might be 1 or 2 things that could be done that will make the code faster, but this should run very quickly. If not, please post the result of time command that should appear at the end of the run, i.e.
real 0m0.18s
user 0m0.03s
sys 0m0.06s
IHTH
#!/bin/bash
i=4
sort $1 | uniq -d | grep ^# > dups.txt
while read in; do
if [ $((i%4))=0 ] && grep -q "$in" dups.txt; then
x="$in"
x=${x/"0:0 "/$i":0 "}
echo "$x" >> $1"fixed.txt"
else
echo "$in" >> $1"fixed.txt"
fi
let "i+=1"
done < $1
This question already has answers here:
How to show only next line after the matched one?
(14 answers)
Closed 6 years ago.
I'm trying to get the current track running from 'cmus-remote -Q'
Its always underneath of this line
tag genre Various
<some track>
Now, I need to keep it simple because I want to add it to my i3 bar. I used
cmus-remote -Q | grep -A 1 "tag genre"
but that grep's the 'tag' line AND the line underneath.
I want ONLY the line underneath.
With sed:
sed -n '/tag genre/{n;p}'
Output:
$ cmus-remote -Q | sed -n '/tag genre/{n;p}'
<some track>
If you want to use grep as the tool for this, you can achieve it by adding another segment to your pipeline:
cmus-remote -Q | grep -A 1 "tag genre" | grep -v "tag genre"
This will fail in cases where the string you're searching for is on two lines in a row. You'll have to define what behaviour you want in that case if we're going to program something sensible for it.
Another possibility would be to use a tool like awk, which allows for greater compexity in the line selection:
cmus-remote -Q | awk '/tag genre/ { getline; print }'
This searches for the string, then gets the next line, then prints it.
Another possibility would be to do this in bash alone:
while read line; do
[[ $line =~ tag\ genre ]] && read line && echo "$line"
done < <(cmus-remote -Q)
This implements the same functionality as the awk script, only using no external tools at all. It's likely slower than the awk script.
You can use awk instead of grep:
awk 'p{print; p=0} /tag genre/{p=1}' file
<some track>
/tag genre/{p=1} - sets a flag p=1 when it encounters tag genre in a line.
p{print; p=0} when p is non-zero then it prints a line and resets p to 0.
I'd suggest using awk:
awk 'seen && seen--; /tag genre/ { seen = 1 }'
when seen is true, print the line.
when seen is true, decrement the value, so it will no longer true after the desired number of lines are printed
when the pattern matches, set seen to the number of lines to be printed
I am creating a bash script to modify and summarize information with grep and sed. But it gets stuck.
#!/bin/bash
# This script extracts some basic information
# from text files and prints it to screen.
#
# Usage: ./myscript.sh </path/to/text-file>
#Extract lines starting with ">#HWI"
ONLY=`grep -v ^\>#HWI`
#replaces A and G with R in lines
ONLYR=`sed -e s/A/R/g -e s/G/R/g $ONLY`
grep R $ONLYR | wc -l
The correct way to write a shell script to do what you seem to be trying to do is:
awk '
!/^>#HWI/ {
gsub(/[AG]/,"R")
if (/R/) {
++cnt
}
END { print cnt+0 }
' "$#"
Just put that in the file myscript.sh and execute it as you do today.
To be clear - the bulk of the above code is an awk script, the shell script part is the first and last lines where the shell just calls awk and passes it the input file names.
If you WANT to have intermediate variables then you can create/print them with:
awk '
!/^>#HWI/ {
only = $0
onlyR = only
gsub(/[AG]/,"R",onlyR)
print "only:", only
print "onlyR:", onlyR
if (/R/) {
++cnt
}
END { print cnt+0 }
' "$#"
The above will work robustly, portably, and efficiently on all UNIX systems.
First of all, and as #fedorqui commented - you're not providing grep with a source of input, against which it will perform line matching.
Second, there are some problems in your script, which will result in unwanted behavior in the future, when you decide to manipulate some data:
Store matching lines in an array, or a file from which you'll later read values. The variable ONLY is not the right data structure for the task.
By convention, environment variables (PATH, EDITOR, SHELL, ...) and internal shell variables (BASH_VERSION, RANDOM, ...) are fully capitalized. All other variable names should be lowercase. Since
variable names are case-sensitive, this convention avoids accidentally overriding environmental and internal variables.
Here's a better version of your script, considering these points, but with an open question regarding what you were trying to do in the last line : grep R $ONLYR | wc -l :
#!/bin/bash
# This script extracts some basic information
# from text files and prints it to screen.
#
# Usage: ./myscript.sh </path/to/text-file>
input_file=$1
# Read lines not matching the provided regex, from $input_file
mapfile -t only < <(grep -v '^\>#HWI' "$input_file")
#replaces A and G with R in lines
for((i=0;i<${#only[#]};i++)); do
only[i]="${only[i]//[AG]/R}"
done
# DEBUG
printf '%s\n' "Here are the lines, after relpace:"
printf '%s\n' "${only[#]}"
# I'm not sure what you were trying to do here. Am I gueesing right that you wanted
# to count the number of R's in ALL lines ?
# grep R $ONLYR | wc -l
I have a file that has two columns of floating point values. I also have a C program that takes a floating point value as input and returns another floating point value as output.
What I'd like to do is the following: for each row in the original, execute the C program with the value in the first column as input, and then print out the first column (unchanged) followed by the second column minus the result of the C program.
As an example, suppose c_program returns the square of the input and behaves like this:
$ c_program 4
16
$
and suppose data_file looks like this:
1 10
2 11
3 12
4 13
What I'd like to return as output, in this case, is
1 9
2 7
3 3
4 -3
To write this in really sketchy pseudocode, I want to do something like this:
awk '{print $1, $2 - `c_program $1`}' data_file
But of course, I can't just pass $1, the awk variable, into a call to c_program. What's the right way to do this, and preferably, how could I do it while still maintaining the "awk one-liner"? (I don't want to pull out a sledgehammer and write a full-fledged C program to do this.)
you just do everything in awk
awk '{cmd="c_program "$1; cmd|getline l;print $1,$2-l}' file
This shows how to execute a command in awk:
ls | awk '/^a/ {system("ls -ld " $1)}'
You could use a bash script instead:
while read line
do
FIRST=`echo $line | cut -d' ' -f1`
SECOND=`echo $line | cut -d' ' -f2`
OUT=`expr $SECOND \* 4`
echo $FIRST $OUT `expr $OUT - $SECOND`
done
The shell is a better tool for this using a little used feature. There is a shell variable IFS which is the Input Field Separator that sh uses to split command lines when parsing; it defaults to <Space><Tab><Newline> which is why ls foo is interpreted as two words.
When set is given arguments not beginning with - it sets the positional parameters of the shell to the contents of the arguments as split via IFS, thus:
#!/bin/sh
while read line ; do
set $line
subtrahend=`c_program $1`
echo $1 `expr $2 - $subtrahend`
done < data_file
Pure Bash, without using any external executables other than your program:
#!/bin/bash
while read num1 num2
do
(( result = $(c_program num2) - num1 ))
echo "$num1 $result"
done
As others have pointed out: awk is not not well equipped for this job. Here is a suggestion in bash:
#!/bin/sh
data_file=$1
while read column_1 column_2 the_rest
do
((result=$(c_program $column_1)-$column_2))
echo $column_1 $result "$the_rest"
done < $data_file
Save this to a file, say myscript.sh, then invoke it as:
sh myscript.sh data_file
The read command reads each line from the data file (which was redirected to the standard input) and assign the first 2 columns to $column_1 and $column_2 variables. The rest of the line, if there is any, is stored in $the_rest.
Next, I calculate the result based on your requirements and prints out the line based on your requirements. Note that I surround $the_rest with quotes to reserve spacing. Failure to do so will result in multiple spaces in the input file to be squeezed into one.