Trying to write a bash script containing nested dollar variables and I can't get it to work :
#!/bin/bash
sed '4s/.*/$(grep "remote.*$1" /home/txtfile)/' /home/target
The error says :
sed / -e expression #1, char 30: unkown option to 's'
The problem seems to come from $1 which need to be replaced by the parameter passed from the bash call and then the whole $(...) needs to be replaced by the command call so we replace the target line 4 by the string output.
Variable expansion and Command substitution won't be done when put inside single quotes, use double quotes instead:
sed "4s/.*/$(grep "remote.*$1" /home/txtfile)/" /home/target
Your approach is wrong, the right way to do what you want is just one command, something like this (depending on your possible $1 values and input file contents which you haven't shown us):
awk -v tgt='remote.*$1' '
NR==FNR { if ($0 ~ tgt) str = str $0 ORS; next }
FNR==4 { printf "%s", str; next }
{ print }
' /home/txtfile /home/target
Related
I want to replace a string in a file with the value of a variable. I a string lvl in the template file prm.prm which needs to be replaced by the value of SLURM_ARRAY.
I tried using
sed -i 's/lvl/${SLURM_ARRAY}/' prm.prm
This replaces the string lvl with ${SLURM_ARRAY} and not its value. How can I rectify this?
Every character between single quotes is used literally.
You could use double quotes instead as follows:
sed -i "s/lvl/${SLURM_ARRAY}/" prm.prm
However, your code now suffers from a code injection bug. There are characters (e.g. /) that will cause problems if found in the value of SLURM_ARRAY. To avoid this, these characters needs to be escaped.
quotemeta() { printf %s "$1" | sed 's/\([^a-zA-Z0-9]\)/\\\1/g'; }
sed -i "s/lvl/$( quotemeta "$SLURM_ARRAY" )/" prm.prm
However, it would be best to avoid generating programs from the shell. But that would require avoiding sed since it doesn't provide the necessary tools. For example, a couple of Perl solutions:
perl -i -spe's/lvl/$s/' -- -s="$SLURM_ARRAY" prm.prm
S="$SLURM_ARRAY" perl -i -pe's/lvl/$ENV{S}/' prm.prm
Replace pattern with the value of an environment variable, with no extra interpolation of the contents:
Using perl:
export SLURM_ARRAY
perl -pe's/lvl/$ENV{SLURM_ARRAY}/g' prm.prm
Using awk:
export SLURM_ARRAY
awk '
{
if (match($0, /lvl/)) {
printf "%s", substr($0, 1, RSTART - 1)
printf "%s", ENVIRON["SLURM_ARRAY"]
print substr($0, RSTART + RLENGTH)
}
else {
print
}
}
' prm.prm
There's also SLURM_ARRAY=$SLURM_ARRAY perl ...etc or similar, to set the environment of a single process.
It can also be done with the variable as an argument. With both perl and awk you can access and modify the ARGV array. For awk you have to reset it so it's not processed as a file. The perl version looks like perl -e 'my $r = $ARGV[0]; while (<STDIN>) {s/lvl/$r/g; print}' "$SLURM_ARRAY" < prm.prm. It looks even better as perl -spe's/lvl/$r/g' -- -r="$SLURM_ARRAY". Thanks to ikegami.
For awk, I should say that the reason for not using awk -v r=foo is the expansion of C escapes. You could also read the value from a file (or bash process substitution).
I have a huge file (this is just a sample) and I would like to select all lines with "Ph_gUFAC1083" and all after until reach one that doesn't have the code (in this example Ph_gUFAC1139)
>uce_353_Ph_gUFAC1083 |uce_353
TTTAGCCATAGAAATGCAGAAATAATTAGAAGTGCCATTGTGTACAGTGCCTTCTGGACT
GGGCTGAAGGTGAAGGAGAAAGTATCATACTATCCTTGTCAGCTGCAAGGGTAATTACTG
CTGGCTGAAATTACTCAACATTTGTTTATAAGCTCCCCAGAGCATGCTGTAAATAGATTG
TCTGTTATAGTCCAATCACATTAAAACGCTGCTCCTTGCAAACTGCTACCTCCTGTTTTC
TGTAAGCTAGACAGAGAAAGCCTGCTGCTCACTTACTGAGCACCAAGCACTGAAGAGCTA
TGTTTAATGTGATTGTTTTCATTAGCTCTTCTCTGTCTGATATTACATTTATAATTTGCT
GGGCTTGAAGACTGGCATGTTGCATTGCTTTCATTTACTGTAGTAAGAGTGAATAGCTCT
AT
>uce_101_Ph_gUFAC1083 |uce_101
TTGGGCTTTATTTCCACCTTAAAATCTTTACCTGGCCGTGATCTGTTGTTCCATTACTGG
AGGGCAAAAATGGGAGGAATTGTCTGGGCTAAATTGCAATTAGGCAGCCCTGAGAGAGGC
TGGCACCAGTTAACTTGGGATATTGGAGTGAAAAGGCCCGTAATCAGCCTTCGGTCATGT
AGAACAATGCATAAAATTAAATTGACATTAATGAATAATTGTGTAATGAAAATGGAAGAG
GAGAGTTAATTGCATGTTACAGTGAGTGTAATGCCTAGATAACCTTGCATTTAATGCTAT
TCTTAGCCCTGCTGCCAAGACTTCTACAGAGCCTCTCTCTGCAGGAAGTCATTAAAGCTG
TGAGTAGATAATGCAGGCTCAGTGAAACCTAAGTGGCAACAATATA
>uce_171_Ph_gUFAC1083 |uce_171
CATGGAAAACGAGGAAAAGCCATATCTTCCAGGCCATTAATATTACTACGGAGACGTCTT
CATATCGCCGTAATTACAGCAGATCTCAAAGTGGCACAACCAAGACCAGCACCAAAGCTA
AAATAACTCGCAGGAGCAGGCGAGCTGCTTTTGCAGCCCTCAGTCCCAGAAATGCTCGGT
AGCTTTTCTTAAAATAGACAGCCTGTAAATAAGGTCTGTGAACTCAATTGAAGGTGGCTG
TTTCTGAATTAGTCAGCCCTCACAAGGCTCTCGGCCTACATGCTAGTACATAAATTGTCC
ACTTTACCACCAGACAAGAAAGATTAGAGTAATAAACACGGGGCATTAGCTCAGCTAGAG
AAACACACCAGCCGTTACGCACACGCGGGATTGCCAAGAACTGTTAACCCCACTCTCCAG
AAACGCACACAAAAAAACAAGTTAAAGCCATGACATCATGGGAA
>uce_4300_Ph_gUFAC1139 |uce_4300
ATTAAAAATACAATCCTCATGTTTGCATTTTGCAGTCGTCAACAAGAAATTGAAGAGAAA
CTCATAGAGGAAGAAACTGCTCGAAGGGTGGAAGAACTTGTAGCTAAACGCGTGGAAGAA
GAGCTGGAGAAAAGAAAGGATGAGATTGAGCGAGAGGTTCTCCGCAGGGTGGAGGAGGCT
AAGCGCATCATGGAAAAACAGTTGCTCGAAGAACTCGAGCGACAGCGACAAGCTGAACTT
GCAGCACAAAAAGCCAGAGAGGTAACGCTCGGTCGTTTGGAAAGTAGAGACAGTCCATGG
CAAAACTTTCAGTGTCGGTTTGTGCCTCCTGTTCGGTTCAGAAAGAGATGGAATACAGCA
AATCTAATTCCCTTCTCATATAAACTTGCATTGCTGCGAAACTTAATTTCTAGCCTATTC
AGAGGAGCTCACTGATATTTAAACAGTTACTCTCCTAAAACCTGAACAAGGATACTTGAT
TCTTAATGGAACTGACCTACATATTTCAGAATTGTTTGAAACTTTTGCCATGGCTGCAGG
ATTATTCAGCAGTCCTTTCATTTT
>uce_1039_Ph_gUFAC1139 |uce_1039
ATTAGTGGAATACAAATATGCAAAAACCAAACAGTTTGGTGCTATAATGTGAAAAGAAAT
TTACACCAATCTTATTTTTAATTTGTATGGGAACATTTTTACCACAAATTCCATATTTTA
ATAATACTATCCCAACTCTATTTTTTAGACTCATTTTGTCACTGTTTTGTAACAGAAACA
CTGTAAATATTATAGATGTGGTAAACTATTATACTTGTTTTCTTATAAATGAAATGATCT
GTGCCAACACTGACAAAATGAATTAATGTGTTACTAAGGCAACAGTCACATTATATGCTT
TCTCTTTCACAGTATGCGGTAGAGCATATGGTTTACTCTTAATGGAACACTAGCTTCTCA
TTAACATACCAGTAGCAATGTCAGAACTTACAAACCAGCATAACAGAGAAATGGAAAAAC
TTATAAATTAGACCCTTTCAGTATTATTGAGTAGAAAATGACTGATGTTCCAAGGTACAA
TATTTAGCTAATACAGTGCCCTTTTCTGCATCTTTCTTCTCAAAGGAAAAAAAAATCCTC
AAAAAAAACCAGAGCAAGAAACCTAACTTTTTCTTGT
I already tried several alternatives without success, the closest I reached was
sed -n '/Ph_gUFAC1083/, />/p' file.txt
that gave me that:
>uce_2347_Ph_gUFAC1083 |uce_2347
GCTTTTCTATGCAGATTTTTTCTAATTCTCTCCCTCCCCTTGCTTCTGTCAGTGTGAAGC
CCACACTAAGCATTAACAGTATTAAAAAGAGTGTTATCTATTAGTTCAATTAGACATCAG
ACATTTACTTTCCAATGTATTTGAAGACTGATTTGATTTGGGTCCAATCATTTAAAAATA
AGAGAGCAGAACTGTGTACAGAGCTGTGTACAGATATCTGTAGCTCTGAAGTCTTAATTG
CAAATTCAGATAAGGATTAGAAGGGGCTGTATCTCTGTAGACCAAAGGTATTTGCTAATA
CCTGAGATATAAAAGTGGTTAAATTCAATATTTACTAATTTAGGATTTCCACTTTGGATT
TTGATTAAGCTTTTTGGTTGAAAACCCCACATTATTAAGCTGTGATGAGGGAAAAAGCAA
CTCTTTCATAAGCCTCACTTTAACGCTTTATTTCAAATAATTTATTTTGGACCTTCTAAA
G
>uce_353_Ph_gUFAC1083 |uce_353
>uce_101_Ph_gUFAC1083 |uce_101
TTGGGCTTTATTTCCACCTTAAAATCTTTACCTGGCCGTGATCTGTTGTTCCATTACTGG
AGGGCAAAAATGGGAGGAATTGTCTGGGCTAAATTGCAATTAGGCAGCCCTGAGAGAGGC
TGGCACCAGTTAACTTGGGATATTGGAGTGAAAAGGCCCGTAATCAGCCTTCGGTCATGT
AGAACAATGCATAAAATTAAATTGACATTAATGAATAATTGTGTAATGAAAATGGAAGAG
GAGAGTTAATTGCATGTTACAGTGAGTGTAATGCCTAGATAACCTTGCATTTAATGCTAT
TCTTAGCCCTGCTGCCAAGACTTCTACAGAGCCTCTCTCTGCAGGAAGTCATTAAAGCTG
TGAGTAGATAATGCAGGCTCAGTGAAACCTAAGTGGCAACAATATA
>uce_171_Ph_gUFAC1083 |uce_171
Do you know how to do it using grep, sed or awk?
Thx
$ awk '/^>/{if(match($0,"Ph_gUFAC1083")){s=1} else s=0}s' file
I made a simple criteria for your request,
If the the start of the line is >, we're going to judge if "Ph_gUFAC1083" existed, if yes, set s=1, set s=0 otherwise.
For the line that doesn't start with >, the value of s would be retained.
The final s in the awk command decide if the line to be printed (s=1) or not (s=0).
If what you want is every line with Ph_gUFAC1139 plus block of lines after that line until the next line starting with >, then the following awk snippet might do:
$ awk 'BEGIN {RS=ORS=">"} /Ph_gUFAC1139/' file.txt
This uses the > character as a record separator, then simply displays records that contain the text you're interested in.
If you wanted to be able to provide the search string using a variable, you'd do it something like this:
$ val="Ph_gUFAC1139"
$ awk -v s="$val" 'BEGIN {RS=ORS=">"} $0 ~ s' file.txt
UPDATE
A comment mentions that the solution above shows trailing record separators rather than leading ones. You can adapt your output to match your input by reversing this order manually:
awk 'BEGIN { RS=ORS=">" } /Ph_gUFAC1139/ { printf "%s%s",ORS,$0 }' file.txt
Note that in the initial examples, a "match" of the regex would invoke awk's default "action", which is to print the line. The default action is invoked if no action is specified within the script. The code (immediately) above includes an action .. which prints the record, preceded by the separator.
This might work for you (GNU sed):
sed '/^>/h;G;/Ph_gUFAC1083/P;d' file
Store each line beginning with > in the hold space (HS) and then append the HS to every line. If any line contains the string Ph_gUFAC1083 print the first line in the pattern space (PS) and discard the everything else.
N.B. the regexp for the match may be amended to /\n.*Ph_gUFAC1083/ if the string match may occur in any line.
This program is used to find the block which starts with Ph_gUFAC1083 and ends with any statement other than Ph_gUFAC1139
cat inp.txt |
awk '
BEGIN{begin=0}
{
# Ignore blank lines
if( $0 ~ /^$/ )
{
print $0
next
}
# mark the line that contains Ph_gUFAC1083 and print it
if( $0 ~ /Ph_gUFAC1083/ )
{
begin=1
print $0
}
else
{
# if the line contains Ph_gUFAC1083 and Ph_gUFAC1139 was found before it, print it
if( begin == 1 && ( $0 ~ /Ph_gUFAC1139/ ) )
{
print $0
}
else
{
# found a line which doesnt contain Ph_gUFAC1139 , mark the end of the block.
begin = 0
}
}
}'
I have this awk statement:
glb_library="my_library"
awk "
/^Direct Dependers of/ { next }
/^---/ { next }
/^$glb_library:/ { ver=\$0; next }
{ gsub(/[[:space:]]/, '', \$0); print ver':'\$0 }
" file
Basically, I have enclosed the awk code in double quotes so that the shell variable glb_library is expanded. I have made sure to escape the $ character to prevent the shell from expanding $0. Followed the guidance from here.
awk gives me this error:
awk: syntax error at source line 5
context is
{ gsub(/[[:space:]]/, >>> ' <<<
I want to understand:
Is it legal to use single quotes inside awk? Why is '' not a null string like "" is?
Does awk treat single and double quotes differently?
My code worked after I escaped the single quotes with backslashes and used \"\" to represent the null string instead of ''.
Never enclose any script in double quotes or you're sentencing yourself to backslash-hell. This is the syntax for what you're trying to do:
glb_library="my_library"
awk -v glb_library="$glb_library" '
/^Direct Dependers of/ { next }
/^---/ { next }
$0 ~ "^"glb_library":" { ver=$0; next }
{ gsub(/[[:space:]]/, ""); print ver":"$0 }
' file
Based on the comments above by awk experts and some research, I am posting this answer:
awk strings are enclosed in double quotes, not single quotes; more precisely: single quotes are not string delimiters in awk, unlike shell
awk attaches no special meaning to single quotes and they need to be enclosed in double quotes if used in string literals
it is best to use single quotes to wrap awk statements on command line, unlike OP's code that's using double quotes (Ed pointed this out clearly)
Further clarification:
"" is the null string in awk, not ''
to use single quotes in an awk string literal, enclose them in double quotes, as in "Ed's answers are great!"
other techniques followed while handling single quotes in awk are:
a) use a variable, as in awk -v q="'" '{ print q }' ...
b) use octal or hex notation, as in awk '{ print "\047"$0"\047" }' ...
Relevant documentation here.
A pragmatic summary:
As Ed Morton's helpful answer sensibly recommends:
Always use single quotes to enclose your awk script as a whole ('...'), which ensures that there's no confusion over what the shell interprets up front, and what awk ends up seeing.
To define strings inside an awk script, always use double quotes ("...").
" is the only string delimiter awk recognizes.
"..." strings are non-interpolating (you cannot embed variable references), but they do recognize control-character sequences such as \n and \t.
A single quote (') has no syntactic meaning inside an awk script, but, - if you're using '...' for your overall script, as recommended - you cannot use a literal ' inside of it anyway, because the shell's single-quoted strings do not permit embedded ' chars.
If you do need to use a literal single quote (') in your awk script, you have three choices:
Pass a variable that defines it, and use awk's string concatenation, based on directly adjoining string literals and variable references:
awk -v q=\' 'BEGIN { print "I" q "m good." }' # -> I'm good
Use an escape sequence inside "..."; for maximum portability and disambiguation, use an octal escape sequence (\047), not a hex one (\x27):
awk 'BEGIN { print "I\047m good." }' # -> I'm good
Use '\'' (sic) to "escape" embedded ' chars. (technically, 3 distinct single-quoted shell string literals are being concatenated)Thanks, snr:awk 'BEGIN { print "I'\''m good" }' # -> I'm good
Can you please help me solve this puzzle? I am trying to print the location of a string (i.e., line #) in a file, first to the std output, and then capture that value in a variable to be used later. The string is “my string”, the file name is “myFile” which is defined as follows:
this is first line
this is second line
this is my string on the third line
this is fourth line
the end
Now, when I use this command directly at the command prompt:
% awk ‘s=index($0, “my string”) { print “line=” NR, “position= ” s}’ myFile
I get exactly the result I want:
% line= 3, position= 9
My question is: if I define a variable VAR=”my string”, why can’t I get the same result when I do this:
% awk ‘s=index($0, $VAR) { print “line=” NR, “position= ” s}’ myFile
It just won’t work!! I even tried putting the $VAR in quotation marks, to no avail? I tried using VAR (without the $ sign), no luck. I tried everything I could possibly think of ... Am I missing something?
awk variables are not the same as shell variables. You need to define them with the -v flag
For example:
$ awk -v var="..." '$0~var{print NR}' file
will print the line number(s) of pattern matches. Or for your case with the index
$ awk -v var="$Var" 'p=index($0,var){print NR,p}' file
using all uppercase may not be good convention since you may accidentally overwrite other variables.
to capture the output into a shell variable
$ info=$(awk ...)
for multi line output assignment to shell array, you can do
$ values=( $(awk ...) ); echo ${values[0]}
however, if the output contains more than one field, it will be assigned it's own array index. You can change it with setting the IFS variable, such as
$ IFS=$(echo -en "\n\b"); values=( $(awk ...) )
which will capture the complete lines as the array values.
I am thinking of using sed for reading .properties file, but was wondering if there is a smarter way to do that from bash script?
This would probably be the easiest way: grep + cut
# Usage: get_property FILE KEY
function get_property
{
grep "^$2=" "$1" | cut -d'=' -f2
}
The solutions mentioned above will work for the basics. I don't think they cover multi-line values though. Here is an awk program that will parse Java properties from stdin and produce shell environment variables to stdout:
BEGIN {
FS="=";
print "# BEGIN";
n="";
v="";
c=0; # Not a line continuation.
}
/^\#/ { # The line is a comment. Breaks line continuation.
c=0;
next;
}
/\\$/ && (c==0) && (NF>=2) { # Name value pair with a line continuation...
e=index($0,"=");
n=substr($0,1,e-1);
v=substr($0,e+1,length($0) - e - 1); # Trim off the backslash.
c=1; # Line continuation mode.
next;
}
/^[^\\]+\\$/ && (c==1) { # Line continuation. Accumulate the value.
v= "" v substr($0,1,length($0)-1);
next;
}
((c==1) || (NF>=2)) && !/^[^\\]+\\$/ { # End of line continuation, or a single line name/value pair
if (c==0) { # Single line name/value pair
e=index($0,"=");
n=substr($0,1,e-1);
v=substr($0,e+1,length($0) - e);
} else { # Line continuation mode - last line of the value.
c=0; # Turn off line continuation mode.
v= "" v $0;
}
# Make sure the name is a legal shell variable name
gsub(/[^A-Za-z0-9_]/,"_",n);
# Remove newlines from the value.
gsub(/[\n\r]/,"",v);
print n "=\"" v "\"";
n = "";
v = "";
}
END {
print "# END";
}
As you can see, multi-line values make things more complex. To see the values of the properties in shell, just source in the output:
cat myproperties.properties | awk -f readproperties.awk > temp.sh
source temp.sh
The variables will have '_' in the place of '.', so the property some.property will be some_property in shell.
If you have ANT properties files that have property interpolation (e.g. '${foo.bar}') then I recommend using Groovy with AntBuilder.
Here is my wiki page on this very topic.
I wrote a script to solve the problem and put it on my github.
See properties-parser
One option is to write a simple Java program to do it for you - then run the Java program in your script. That might seem silly if you're just reading properties from a single properties file. However, it becomes very useful when you're trying to get a configuration value from something like a Commons Configuration CompositeConfiguration backed by properties files. For a time, we went the route of implementing what we needed in our shell scripts to get the same behavior we were getting from CompositeConfiguration. Then we wisened up and realized we should just let CompositeConfiguration do the work for us! I don't expect this to be a popular answer, but hopefully you find it useful.
If you want to use sed to parse -any- .properties file, you may end up with a quite complex solution, since the format allows line breaks, unquoted strings, unicode, etc: http://en.wikipedia.org/wiki/.properties
One possible workaround would using java itself to preprocess the .properties file into something bash-friendly, then source it. E.g.:
.properties file:
line_a : "ABC"
line_b = Line\
With\
Breaks!
line_c = I'm unquoted :(
would be turned into:
line_a="ABC"
line_b=`echo -e "Line\nWith\nBreaks!"`
line_c="I'm unquoted :("
Of course, that would yield worse performance, but the implementation would be simpler/clearer.
In Perl:
while(<STDIN>) {
($prop,$val)=split(/[=: ]/, $_, 2);
# and do stuff for each prop/val
}
Not tested, and should be more tolerant of leading/trailing spaces, comments etc., but you get the idea. Whether you use Perl (or another language) over sed is really dependent upon what you want to do with the properties once you've parsed them out of the file.
Note that (as highlighted in the comments) Java properties files can have multiple forms of delimiters (although I've not seen anything used in practice other than colons). Hence the split uses a choice of characters to split upon.
Ultimately, you may be better off using the Config::Properties module in Perl, which is built to solve this specific problem.
I have some shell scripts that need to look up some .properties and use them as arguments to programs I didn't write. The heart of the script is a line like this:
dbUrlFile=$(grep database.url.file etc/zocalo.conf | sed -e "s/.*: //" -e "s/#.*//")
Effectively, that's grep for the key and filter out the stuff before the colon and after any hash.
if you want to use "shell", the best tool to parse files and have proper programming control is (g)awk. Use sed only simple substitution.
I have sometimes just sourced the properties file into the bash script. This will lead to environment variables being set in the script with the names and contents from the file. Maybe that is enough for you, too. If you have to do some "real" parsing, this is not the way to go, of course.
Hmm, I just run into the same problem today. This is poor man's solution, admittedly more straightforward than clever;)
decl=`ruby -ne 'puts chomp.sub(/=(.*)/,%q{="\1";}).gsub(".","_")' my.properties`
eval $decl
then, a property 'my.java.prop' can be accessed as $my_java_prop.
This can be done with sed or whatever, but I finally went with ruby for its 'irb' which was handy for experimenting.
It's quite limited (dots should be replaced only before '=',no comment handling), but could be a starting point.
#Daniel, I tried to source it, but Bash didn't like dots in variable names.
I have had some success with
PROPERTIES_FILE=project.properties
function source_property {
local name=$1
eval "$name=\"$(sed -n '/^'"$name"'=/,/^[A-Z]\+_*[A-Z]*=/p' $PROPERTIES_FILE|sed -e 's/^'"$name"'=//g' -e 's/"/\\"/g'|head -n -1)\""
}
source_property 'SOME_PROPERTY'
This is a solution that properly parses quotes and terminates at a space when not given quotes. It is safe: no eval is used.
I use this code in my .bashrc and .zshrc for importing variables from shell scripts:
# Usage: _getvar VARIABLE_NAME [sourcefile...]
# Echos the value that would be assigned to VARIABLE_NAME
_getvar() {
local VAR="$1"
shift
awk -v Q="'" -v QQ='"' -v VAR="$VAR" '
function loc(text) { return index($0, text) }
function unquote(d) { $0 = substr($0, eq+2) d; print substr($0, 1, loc(d)-1) }
{ sub(/^[ \t]+/, ""); eq = loc("=") }
substr($0, 1, eq-1) != VAR { next } # assignment is not for VAR: skip
loc("=" QQ) == eq { unquote(QQ); exit }
loc("=" Q) == eq { unquote( Q); exit }
{ print substr($1, eq + 1); exit }
' "$#"
}
This saves the desired variable name and then shifts the argument array so the rest can be passed as files to awk.
Because it's so hard to call shell variables and refer to quote characters inside awk, I'm defining them as awk variables on the command line. Q is a single quote (apostrophe) character, QQ is a double quote, and VAR is that first argument we saved earlier.
For further convenience, there are two helper functions. The first returns the location of the given text in the current line, and the second prints the content between the first two quotes in the line using quote character d (for "delimiter"). There's a stray d concatenated to the first substr as a safety against multi-line strings (see "Caveats" below).
While I wrote the code for POSIX shell syntax parsing, that appears to only differ from your format by whether there is white space around the asignment. You can add that functionality to the above code by adding sub(/[ \t]*=[ \t]*/, "="); before the sub(…) on awk's line 4 (note: line 1 is blank).
The fourth line strips off leading white space and saves the location of the first equals sign. Please verify that your awk supports \t as tab, this is not guaranteed on ancient UNIX systems.
The substr line compares the text before the equals sign to VAR. If that doesn't match, the line is assigning a different variable, so we skip it and move to the next line.
Now we know we've got the requested variable assignment, so it's just a matter of unraveling the quotes. We do this by searching for the first location of =" (line 6) or =' (line 7) or no quotes (line 8). Each of those lines prints the assigned value.
Caveats: If there is an escaped quote character, we'll return a value truncated to it. Detecting this is a bit nontrivial and I decided not to implement it. There's also a problem of multi-line quotes, which get truncated at the first line break (this is the purpose of the "stray d" mentioned above). Most solutions on this page suffer from these issues.
In order to let Java do the tricky parsing, here's a solution using jrunscript to print the keys and values in a bash read-friendy (key, tab character, value, null character) way:
#!/usr/bin/env bash
jrunscript -e '
p = new java.util.Properties();
p.load(java.lang.System.in);
p.forEach(function(k,v) { out.format("%s\t%s\000", k, v); });
' < /tmp/test.properties \
| while IFS=$'\t' read -d $'\0' -r key value; do
key=${key//./_}
printf -v "$key" %s "$value"
printf '=> %s = "%s"\n' "$key" "$value"
done
I found printf -v in this answer by #david-foerster.
To quote jrunscript: Warning: Nashorn engine is planned to be removed from a future JDK release