I've got all the lines in a proteins_num sorted numerically, I now need to combine the lines with identical number in a way so that new information is added to the upper line:
When I've sorted all the lines numerically, I need to combinde the lines with identical number in a way so that new information is added to the upper line. Take for instance the lines with no 61:
: Col | : 1 | : 2 | : 3 | : 4 | : 5 | : 6 | :7 | : 8 | : 9 | : 10 | : 11
: ----| : 61| :PTS... cyt 1bl.. 0,38 MONOMER homo-trimer FRUC... PER...Bac..
61 PTS... 3
becomes:
Col 1 2 3 4 5 6 7 8 9 10 11
61 PTS... cyt 1bl.. 0,38 MONOMER homo-trimer FRUC... PER...Bac.. 3
Sometimes there'll be information missing in some columns in the upper line that is found in the lower one. Therefore the order of joining must be concise.
Is If there are info in both lines that doable?
The file is here with 1021 lines
https://www.dropbox.com/s/yuu46crp7ql4z65/Proteins_num.txt?dl=0
An awk/gawk solution could be:
gawk '
BEGIN { SEQ="" };
$1 == SEQ { $1=""; printf("%s\t",$0)};
$1 != SEQ { SEQ=$1; printf("\n%s",$0);}
' Proteins_num.txt
where SEQ is the number at beginning of line. When it detects a numeration change, print last line with carriage return. If no change is detected, line is printed without break line, to join with next line. File must be numerical sorted previously.
Related
I have files on the order of a few dozen gigabytes (genome data) on which I need to find the number of occurrences for a substring. While the answers I've seen here use grep -o then wc -l, this seems like a hacky way that might not work for the very large files I need to work with.
Does the grep -o/wc -l method scale well for large files? If not, how else would I go about doing it?
For example,
aaataaaagtcgaaaaagtccatgcatatgatacttttttttttttttttt
111
222
333
444
555
666
must return 6 occurrences for aaa. (Except there are maybe 10 million more lines of this.)
Find 6 overlapping substrings aaa in the string
line="aaataaaagtcgaaaaagtccatgcatatgatacttttttttttttttttt"
You don't want to see the strings, you want to count them.
When you try
# wrong
grep -o -F "aaa" <<< "${line}" | wc -l
you are missing the overlapping strings.
With the substring aaa you have 5 hits in aaaaaaa, so how handle ${line}?
Start with
grep -Eo "a{3,}" <<< "${line}"
Result
aaa
aaaa
aaaaa
Hom many hits do we have? 1 for aaa, 2 for aaaa and 3 for aaaaa.
Compare the total count of characters with the number of lines (wc):
match lines chars add_to_total
aaa 1 4 1
aaaa 1 5 2
aaaaa 1 6 3
For each line substract 3 from the total count of characters for that line.
When the result has 3 lines and 15 characters, calculate
15 characters - (3 lines * 3 characters) = 15 - 9 = 6
In code:
read -r lines chars < <(grep -Eo "a{3,}" <<< "${line}" | wc -lc)
echo "Substring count: $((chars - (3 * lines)))"
Or for a file
read -r lines chars < <(grep -Eo "a{3,}" "${file}" | wc -lc)
echo "Substring count: $((chars - (3 * lines)))"
aaa was "easy", how about other searchstrings?
I think you have to look for the substring and think of a formula that works for that substring. abcdefghi will have no overlapping strings, but abcdabc might.
Potential matches with abcdabc are
abcdabc
abcdabcdabc
abcdabcdabcdabc
Use testline
line="abcdabcdabcdabc something else abcdabcdabcdabc no match here abcdabc and abcdabcdabc"
you need "abc(dabc)+" and have
match lines chars add_to_total
abcdabcdabcdabc 1 16 3
abcdabcdabcdabc 1 16 3
abcdabc 1 8 1
abcdabcdabc 1 12 2
For each line substract 4 from the total count of characters and divide the answer by 4. Or (characters/4) - nr_line. When the result has 4 lines and 52 characters, calculate
(52 characters / fixed 4) / 4 lines = 13 - 4 = 9
In code:
read -r lines chars < <(grep -Eo "abc(dabc)+" <<< "${line}" | wc -lc)
echo "Substring count: $(( chars / 4 - lines))"
When you have a large file, you might want to split it first.
I suppose there are 2 approaches to this (both methods report 29/6 for the 2 test lines):
Use the summation method :
# WHINY_USERS=1 is a shell param for mawk-1 to pre-sort array
${input……} | WHINY_USERS=1 {m,g}awk '
BEGIN {
1 FS = "[^a]+(aa?[^a]+)*"
1 OFS = "|"
1 PROCINFO["sorted_in"] = "#ind_str_asc"
} {
2 _ = ""
2 OFS = "|"
2 gsub("^[|]*|[|]*$",_, $!(NF=NF))
2 split(_,__)
split($-_,___,"[|]+")
12 for (_ in ___) {
12 __[___[_]]++
}
2 _____=____=_<_
2 OFS = "\t"
2 print " -- line # "(NR)
7 for (_ in __) {
7 print sprintf(" %20s",_), __[_], \
______=__[_] * (length(_)-2),\
"| "(____+=__[_]), _____+=______
}
print "" }'
|
-- line # 1
aaa 3 3 | 3 3
aaaa 2 4 | 5 7
aaaaa 3 9 | 8 16
aaaaaaaaaaaaaaa 1 13 | 9 29
-- line # 2
aaa 1 1 | 1 1
aaaa 1 2 | 2 3
aaaaa 1 3 | 3 6
Print out all the copies of that substring :
{m,g}awk' {
2 printf("%s%.*s",____=$(_=_<_),_, NF=NF)
9 do { _+=gsub(__,_____)
} while(index($+__,__))
2 if(_) {
2 ____=substr(____,-_<_,_)
2 gsub(".", (":")__, ____)
2 print "}-[(# " (_) ")]--;\f\b" substr(____, 2)
} else { print "" } }' FS='[^a]+(aa?[^a]+)*' OFS='|' __='aaa' _____='aa'
|
aaagtcgaaaaagtccatgcaaataaaagtcgaaaaagtccatgcatatgatactttttttttt
tttttttaaagtcgaaaaagaaaaaaaaaaaaaaatataaaatccatgc}-[(# 29)]--;
aaa:aaa:aaa:aaa:aaa:aaa:aaa:aaa:aaa:aaa:aaa:aaa:aaa:aaa:aaa:aaa:
aaa:aaa:aaa:aaa:aaa:aaa:aaa:aaa:aaa:aaa:aaa:aaa:aaa
aaataaaagtcgaaaaagtccatgcatatgatacttttttttttttttttt}-[(# 6)]--;
aaa:aaa:aaa:aaa:aaa:aaa
I have some ascii files I’m processing, with 35 columns each, and variable number of rows. I need to take the difference between two columns (N+1), and place the results into a duplicate ascii file on column number 36. Then, I need to take another column, and divide it (row by row) by column 36, and place that result into the same duplicate ascii file in column 37.
I’ve done similar processing in the past, but by outputting temp files for each awk command, reading each successive temp file in to eventually create a final ascii file. Then, I would delete the temp files after. I’m hoping there is an easier/faster method than having to create a bunch of temp files.
Below is an initial working processing step, that the above awk commands would need to follow and fit into. This step gets the data from foo.txt, removes the header, and processes only the rows containing a particular, but varying, string.
cat foo.txt | tail -n +2 | awk '$17 ~ /^[F][0-9][0-9][0-9]$/' >> foo_new.txt
There’s another processing step for different data files, that I would also need the 2 new columns discussed earlier. This is simply appending a unique file name from what’s being catted to the last column of every row in a new ascii file. This command is actually in a loop with varying input files, but I’ve simplified it here.
cat foo.txt | tail -n +2 | awk -v fname="$fname" '{print $0 OFS fname;}' >> foo_new.txt
An example of one of the foo.txt files.
20 0 5 F001
4 2 3 F002
12 4 8 F003
100 10 29 O001
Below would be the example foo_new.txt desired. The requested 2 columns of output from awk (last 2 columns). In this example, column 5 is the difference between column 3 and 2 plus 1. Column 6 is the result of column 1 divided by column 5.
20 0 5 F001 6 3.3
4 2 3 F002 2 2.0
12 4 8 F003 5 2.4
For the second example foo_new.txt. The last column is an example of fname. These are computed in the shell script, and passed to awk. I don't care if the results in column 7 (fname) are at the end or placed between columns 4 and 5, so long as it gets along with the other awk statements.
20 0 5 F001 6 3.3 C1
4 2 3 F002 2 2.0 C2
12 4 8 F003 5 2.4 C3
The best luck so far, but unfortunately this is producing a file with the original output first, and the added output below it. I'd like to have the added output appended on as columns (#5 and #6).
cat foo.txt | tail -n +2 | awk '$17 ~ /^[F][0-9][0-9][0-9]$/' >> foo_new.txt
cat foo_new.txt | awk '{print $4=$3-$2+1, $5=$1/($3-$2+1)}' >> foo_new.txt
Consider an input file data with header line like this (based closely on your minimal example):
Col1 Col2 Col3 Col4
20 0 5 F001
4 2 3 F002
12 4 8 F003
100 10 29 O001
You want the output to contain a column 5 that is the value of $3 - $2 + 1 (column 3 minus column 2 plus 1), and a column 6 that is the value of column 1 divided by column 5 (with 1 decimal place in the output), and a file name that is based on a variable fname passed to the script but that has a unique value for each line. And you only want lines where column 4 matches F and 3 digits, and you want to skip the first line. That can all be written directly in awk:
awk -v fname=C '
NR == 1 { next }
$4 ~ /^F[0-9][0-9][0-9]$/ { c5 = $3 - $2 + 1
c6 = sprintf("%.1f", $1 / c5)
print $0, c5, c6, fname NR
}' data
You could write that on one line too:
awk -v fname=C 'NR==1{next} $4~/^F[0-9][0-9][0-9]$/ { c5=$3-$2+1; print $0,c5,sprintf("%.1f",$1/c5), fname NR }' data
The output is:
20 0 5 F001 6 3.3 C2
4 2 3 F002 2 2.0 C3
12 4 8 F003 5 2.4 C4
Clearly, you could change the file name so that the counter starts from 0 or 1 by using counter++ or ++counter respectively in place of the NR in the print statement, and you could format it with leading zeros or whatever else you want with sprintf() again. If you want to drop the first line of each file, rather than just the first file, change the NR == 1 condition to FNR == 1 instead.
Note that this does not need the preprocessing provided by cat foo.txt | tail -n +2.
I need to take the difference between two columns (N+1), and place the results into a duplicate ascii file on column number 36. Then, I need to take another column, and divide it (row by row) by column 36, and place that result into the same duplicate ascii file in column 37.
That's just:
awk -vN=9 -vanother_column=10 '{ v36 = $N - $(N+1); print $0, v36, $another_column / v36 }' input_file.tsv
I guess your file has some "header"/special "first line", so if it's the first line, then preserve it:
awk ... 'NR==1{print $0, "36_header", "37_header"} NR>1{ ... the script above ... }`
Taking first 3 columns from the example script you presented, and substituting N for 2 and another_column for 1, we get the following script:
# recreate input file
cat <<EOF |
20 0 5
4 2 3
12 4 8
100 10 29
EOF
tr -s ' ' |
tr ' ' '\t' > input_file.tsv
awk -vOFS=$'\t' -vIFS=$'\t' -vN=2 -vanother_column=1 '{ tmp = $(N + 1) - $N; print $0, tmp, $another_column / tmp }' input_file.tsv
and it will output:
20 0 5 5 4
4 2 3 1 4
12 4 8 4 3
100 10 29 19 5.26316
Such script:
awk -vOFS=$'\t' -vIFS=$'\t' -vN=2 -vanother_column=1 '{ tmp = $(N + 1) - $N + 1; print $0, tmp, sprintf("%.1f", $another_column / tmp) }' input_file.tsv
I think get's closer output to what you want:
20 0 5 6 3.3
4 2 3 2 2.0
12 4 8 5 2.4
100 10 29 20 5.0
And I guess that by that (N+1) you meant "the difference between two columns with 1 added".
Im stuck on some homework. The requirements of the assignment are to accept an input file and perform some statistics on the values. The user may specify whether to calculate the statistics by row or by value. The shell script must be pure bash script so I can't use awk, sed, perl, python etc.
sample input:
1 1 1 1 1 1 1
39 43 4 3225 5 2 2
6 57 8 9 7 3 4
3 36 8 9 14 4 3
3 4 2 1 4 5 5
6 4 4814 7 7 6 6
I can't figure out how to sort and process the data by column. My code for processing the rows works fine.
# CODE FOR ROWS
while read -r line
echo $(printf "%d\n" $line | sort -n) | tr ' ' \\t > sorted.txt
....
#I perform the stats calculations
# for row line by working with the temp file sorted.txt
done
How could I process this data by column? I've never worked with shell script so I've been staring at this for hours.
If you wanted to analyze by columns you'll need the cols value first (number of columns). head -n 1 gives you the first row, and NF counts the number of fields, giving us the number of columns.
cols=$(head -n 1 test.txt | awk '{print NF}');
Then you can use cut with the '\t' delimiter to grab every column from input.txt, and run it through sort -n, as you did in your original post.
$ for i in `seq 2 $((cols+1))`; do cut -f$i -d$'\t' input.txt; done | sort -n > output.txt
For rows, you can use the shell built-in printf with the format modifier %dfor integers. The sort command works on lines of input, so we replace spaces ' ' with newlines \n using the tr command:
$ cat input.txt | while read line; do echo $(printf "%d\n" $line); done | tr ' ' '\n' | sort -n > output.txt
Now take the output file to gather our statistics:
Min: cat output.txt | head -n 1
Max: cat output.txt | tail -n 1
Sum: (courtesy of Dimitre Radoulov): cat output.txt | paste -sd+ - | bc
Mean: (courtesy of porges): cat output.txt | awk '{ $total += $2 } END { print $total/NR }'
Median: (courtesy of maxschlepzig): cat output.txt | awk ' { a[i++]=$1; } END { print a[int(i/2)]; }'
Histogram: cat output.txt | uniq -c
8 1
3 2
4 3
6 4
3 5
4 6
3 7
2 8
2 9
1 14
1 36
1 39
1 43
1 57
1 3225
1 4814
I am thinking on the following problem.
I can have an array of strings like
Col1 Col2 Col3 Col4
aa aa aa aa
aaa aaa aaaaa aaa
aaaa aaaaaaa aa a
...........................
Actually it is CSV file. And I should find a way to divide this vertically into one or more files. Condition for splitting is that no one file contain no row that exceeds some bytes. For simplicity we can rewrite that array with lengths:
Col1 Col2 Col3 Col4
2 2 2 2
3 3 5 3
4 7 2 1
...........................
And let's say the limit is 10, i.e. if > 9 we should split. So if we split into 2 files [Col1, Col2, Col3] and [Col4] this will not satisfy the condition because the first file will contain 3 + 3 + 5 > 9 in the second row and 4 + 7 + 2 > 9 in the third row. If we split into [Col1, Col2] and [Col3, Col4] this will not satisfy the condition because the first file will contain 4 + 7 > 9 in the third row. So we are splitting this into 3 files like [Col1], [Col2, Col3] and [Col4]. Now every file is correct and looks like:
File1 | File2 | File3
------------------------------
Col1 | Col2 Col3 | Col4
2 | 2 2 | 2
3 | 3 5 | 3
4 | 7 2 | 1
...............................
So it should split from left to right giving maximum columns as possible to the left file. The problem is that this file can be huge and I don't want to read it into memory and so we read the initial file line by line and somehow I should determine a set of indexes to split. If that is possible at all? I hope I described the problem well, so you can understand it.
Generally awk is quite good at handling large csv files.
You could try something like this to retrieve the max length for each column and then decide how to split.
Let's say the file.txt contains
Col1;Col2;Col3;Col4
aa;aa;aa;aa
aaa;aaa;aaaaa;aaa
aaaa;aaaaaaa;aa;a
(Assuming windows style quotes) Running the following :
> awk -F";" "NR>1{for (i=1; i<=NF; i++) max[i]=(length($i)>max[i]?length($i):max[i])} END {for (i=1; i<=NF; i++) printf \"%d%s\", max[i], (i==NF?RS:FS)}" file.txt
Will output :
4;7;5;3
Could you try this on your real data set ?
I have a file with all different integer in which each line may have different lenghts, like this:
1 2 3 4 5
16 7 8
9 10 101 102 13 14
15 6 17
24 28 31 30 18
I would like to print in output the number of elements that a line presents and the number of times there is the same number of elements per lines; the output of this example should be:
3 2
5 2
6 1
In the first column there are the number of elements per line, in the second the number of lines that presents the same number of elements.
The first line in the file has 5 elements and also the 5th one etc etc.
Print the count for the number of fields:
$ awk '{a[NF]++}END{for(k in a)print k,a[k]}' file
5 2
6 1
3 2
Pipe to sort for ordered output:
$ awk '{a[NF]++}END{for(k in a)print k,a[k]}' file | sort
3 2
5 2
6 1