I am leaning how to use awk and sed this week. I know this question might have been asked before but I am not sure what is wrong with my script. I have three files and I am using grep to search for the pattern gge0001x gge0001y gge0001z. x is in file1, y is in file 2, and z is in file3. If anyone wants to see L2E[1-3].iva they are here: https://gist.github.com/anonymous/1112988408874c730cd4f3d313226ba4
#!/bin/bash
echo "Performance Data"
sed -n '1,19p' L2E1.iva|cat > file1 #take lines 1-19 in L2E1 and take the
# output into file1. The next two commands do the same thing
sed -n '1,19p' L2E2.iva|cat > file2
sed -n '1,19p' L2E3.iva|cat > file3
curveName=`grep "F" file1|sed "s/F/ /"`
# This will search for F in file 1, and then substitute F with a space
curveName2=`grep "F" file2|sed "s/F/ /"`
curveName3=`grep "F" file3|sed "s/F/ /"`
echo "Curve Name" "$curveName $curveName2 $curveName3"
I want my output to be Curve Name gge0001x gge0001y gge0001z. But the output is this instead:
Performance Data gge0006ze gge0006x
If I echo them out by themselves then it is fine, but once I echo all three on the same line the output gets skewed. Why does x show up last when it is first when I echo it and where did my y go to?
A few tips at first:
sed -n '1,19p' L2E1.iva|cat > file1
You can omit the cat an redirect the output of sed directly to the file:
sed -n '1,19p' L2E1.iva > file1
curveName=`grep "F" file1|sed "s/F/ /"`
Use $() instead of backticks for process substitution:
curveName=$(grep "F" file1 | sed "s/F/ /")
But the output is this instead: Performance Data gge0006ze gge0006x
The reason for Performance Data in your output is, that you echo it at the beginning of your script.
Moreover you've got a typo in the last echo: $curvename2 -> $curveName2, this is why your y is missing.
Did you double check your files for the right contents? That's the only reason i can imagine, why your x comes last and the z first.
You can perhaps compress your script into one line
$ echo Curve name $(grep -Pohm1 '(?<=F ).*' L2E{1..3})
Curve name gge0006x gge0006y gge0006z
exercise is to search the options used in grep
Related
my bash for loop looks like:
for i in read_* ; do
cut -f1 $i | sponge $i
sed -i '1 s/^/>/g' $i
sed -i '3 s/^/>ref\n/g' $i
sed -i '4d' $i
sed -i '1h;2H;1,2d;4G' $i
mv $i $i.fasta
done
Are there any methods of speeding up this process, perhaps using GNU parallel?
EDIT: Added input and expected output.
Input:
sampleid 97 stuff 2086 42 213M = 3322 1431
TATTTAGGGAAGATCTGGCCTTCCTACAAGGGAAGGCCAGGGAATTTTCTTCAGAGCAGA
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
TTTTTAGGGAAGATCTGGCCTTCCTACAAGGGAAGGCCAGGGAATTTTCTTCAGAGCAGA
Hopeful output:
>ref
TTTTTAGGGAAGATCTGGCCTTCCTACAAGGGAAGGCCAGGGAATTTTCTTCAGAGCAGA
>sampleid
TATTTAGGGAAGATCTGGCCTTCCTACAAGGGAAGGCCAGGGAATTTTCTTCAGAGCAGA
I used the sed -i '1h;2H;1,2d;4G' $i command to swap lines 2 and 4.
If I read it right, this should create the same result, though it would probably help a LOT if I could see what your input and expected output look like...
awk '{$0=$1}
FNR==1{hd=">"$0; next}
FNR==2{hd=hd"\n"$0;next}
FNR==3{print ">ref\n"$0 > FILENAME".fasta"}
FNR==4{next}
FNR==5{print hd"\n"$0 > FILENAME".fasta"}
' read_*
My input files:
$: cat read_x
foo x
bar x
baz x
last x
curiosity x
$: cat read_y
FOO y
BAR y
BAZ y
LAST y
CURIOSITY y
and the resulting output files:
$: cat read_x.fasta
>ref
baz
>foo
bar
curiosity
$: cat read_y.fasta
>ref
BAZ
>FOO
BAR
CURIOSITY
This runs in one pass with no loop aside from awk's usual internals, and leaves the originals in place so you can check it first. If all is good, all that's left is to remove the originals. For that, I would use extended globbing.
$: shopt -s extglob; rm read_!(*.fasta)
That will clean up the original inputs but not the new outputs.
Same results, three commands, no loops.
I am, or course, making some assumptions about what you are meaning to do that might not be accurate. To get this format in a single sed call -
$: sed -e 's/[[:space:]].*//' -e '1{s/^/>/;h;d}' -e '2{H;s/.*/>ref/}' -e '4x' read_x
>ref
baz
>foo
bar
curiosity
but that's not the same commands you used, so maybe I'm misreading it.
To use this to in-place edit multiple files at a time (instead of calling it in a loop on each file), use -si so that the line numbers apply to each file rather than the stream of records they collectively produce.
DON'T use -is, though you could use -i -s.
$: sed -s -i -e 's/[[:space:]].*//' -e '1{s/^/>/;h;d}' -e '2{H;s/.*/>ref/}' -e '4x' read_*
This still leaves you with the issue of renaming each, but xargs makes that pretty easy in the given example.
printf "%s\n" read_* | xargs -I# mv # #.fasta
addendum
Using the file you gave in the OP, assuming every file is the same general structure and exactly 4 lines -
$: cat file_0 # I made files 0 through 7, but with same data
sampleid 97 stuff 2086 42 213M = 3322 1431
TATTTAGGGAAGATCTGGCCTTCCTACAAGGGAAGGCCAGGGAATTTTCTTCAGAGCAGA
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
TTTTTAGGGAAGATCTGGCCTTCCTACAAGGGAAGGCCAGGGAATTTTCTTCAGAGCAGA
$: sed -Esi '1{s/^([^[:space:]]+).*/>\1/;h;s/.*/>ref/}; 3x;' file_?
$: cat file_0 # used a diff on each, worked on all at once
>ref
TATTTAGGGAAGATCTGGCCTTCCTACAAGGGAAGGCCAGGGAATTTTCTTCAGAGCAGA
>sampleid
TTTTTAGGGAAGATCTGGCCTTCCTACAAGGGAAGGCCAGGGAATTTTCTTCAGAGCAGA
Breakout:
-Esi Extended pattern matching, separate file linecounts, in-place edits
1{...}; Collectively do these commands, in order, only on every line 1
s/^([^[:space:]]+).*/>\1/ add leading > but strip everything after any whitespace
h store the resulting >\1 line in the hold buffer
s/.*/>ref/ then replace the whole line with a literal >ref
`3x' swap line 3 with the value in the hold buffer from line 1
file_? I used a glob to supply the appropriate list of files all at once.
Doing same with awk:
$: awk 'FNR==1{id=">"$1; print ">ref" >FILENAME".fasta"; next} FNR==3{print id > FILENAME".fasta"; next} {print $0 > FILENAME".fasta"}' file_?
Then you can do file management as above with the xargs/mv for the sed or the shopt/rm for the awk - or we could add a little organizational work in awk if you like. Consider this:
awk 'BEGIN { system(" mkdir -p done ") }
FNR==1 { id=">"$1; print ">ref" > FILENAME".fasta"; next } # skip printing original
FNR==3 { print id > FILENAME".fasta"; next } # skip printing original
{ print $0 > FILENAME".fasta" } # every line NOT skipped
FNR==4 { close(FILENAME); close(FILENAME".fasta");
system("mv " FILENAME " done/")
}' file_?
Then if there are any problems, it's easy to delete the fasta's, move the originals back, adjust the code, and try again. If everything is ok, it's fast and easy to rm -fr done, yes?
Note that I really only added the mkdir inside a system call in the awk to show that you can, and to keep from having to manually do it separately if you have to run a few iterations or move it all into a wrapper script, etc.
The code in the question runs multiple subprocesses (cut, sponge, sed four times, and mv) for each file that is processed. Running subprocesses is relatively slow, so you can speed up the code significantly by reducing the number of them.
This Shellcheck-clean code is one way to do it:
#! /bin/bash -p
old_files=()
for f in read_* ; do
readarray -t lines <"$f"
printf '>ref\n%s\n>%s\n%s\n' \
"${lines[3]}" "${lines[0]%%[[:space:]]*}" "${lines[1]}" >"$f.fasta"
old_files+=( "$f" )
done
rm -- "${old_files[#]}"
This runs no subprocesses when processing individual files. It just reads the lines of the old file into an array using the built-in readarray command and writes to the new file using the built-in printf.
See Removing part of a string (BashFAQ/100 (How do I do string manipulation in bash?)) for an explanation of the %% in ${lines[0]%%[[:space:]]*}.
To avoid running rm for each file, the code keeps a list of files to be deleted and removes all of them at the end. If you try the code, consider commenting the rm line until you are very confident that the rest of the code is doing what you want.
I have multiple files /text-1.txt, /text-2.txt ... /text-20.txt
and what I want to do is to grep for two patterns and stitch them into one file.
For example:
I have
grep "Int_dogs" /text-1.txt > /text-1-dogs.txt
grep "Int_cats" /text-1.txt> /text-1-cats.txt
cat /text-1-dogs.txt /text-1-cats.txt > /text-1-output.txt
I want to repeat this for all 20 files above. Is there an efficient way in bash/awk, etc. to do this ?
#!/bin/sh
count=1
next () {
[[ "${count}" -lt 21 ]] && main
[[ "${count}" -eq 21 ]] && exit 0
}
main () {
file="text-${count}"
grep "Int_dogs" "${file}.txt" > "${file}-dogs.txt"
grep "Int_cats" "${file}.txt" > "${file}-cats.txt"
cat "${file}-dogs.txt" "${file}-cats.txt" > "${file}-output.txt"
count=$((count+1))
next
}
next
grep has some features you seem not to be aware of:
grep can be launched on lists of files, but the output will be different:
For a single file, the output will only contain the filtered line, like in this example:
cat text-1.txt
I have a cat.
I have a dog.
I have a canary.
grep "cat" text-1.txt
I have a cat.
For multiple files, also the filename will be shown in the output: let's add another textfile:
cat text-2.txt
I don't have a dog.
I don't have a cat.
I don't have a canary.
grep "cat" text-*.txt
text-1.txt: I have a cat.
text-2.txt: I don't have a cat.
grep can be extended to search for multiple patterns in files, using the -E switch. The patterns need to be separated using a pipe symbol:
grep -E "cat|dog" text-1.txt
I have a dog.
I have a cat.
(summary of the previous two points + the remark that grep -E equals egrep):
egrep "cat|dog" text-*.txt
text-1.txt:I have a dog.
text-1.txt:I have a cat.
text-2.txt:I don't have a dog.
text-2.txt:I don't have a cat.
So, in order to redirect this to an output file, you can simply say:
egrep "cat|dog" text-*.txt >text-1-output.txt
Assuming you're using bash.
Try this:
for i in $(seq 1 20) ;do rm -f text-${i}-output.txt ; grep -E "Int_dogs|Int_cats" text-${i}.txt >> text-${i}-output.txt ;done
Details
This one-line script does the following:
Original files are intended to have the following name order/syntax:
text-<INTEGER_NUMBER>.txt - Example: text-1.txt, text-2.txt, ... text-100.txt.
Creates a loop starting from 1 to <N> and <N> is the number of files you want to process.
Warn: rm -f text-${i}-output.txt command first will be run and remove the possible outputfile (if there is any), to ensure that a fresh new output file will be only available at the end of the process.
grep -E "Int_dogs|Int_cats" text-${i}.txt will try to match both strings in the original file and by >> text-${i}-output.txt all the matched lines will be redirected to a newly created output file with the relevant number of the original file. Example: if integer number in original file is 5 text-5.txt, then text-5-output.txt file will be created & contain the matched string lines (if any).
I want to match the numbers in the first file with the 2nd column of second file and get the matching lines in a separate output file. Kindly let me know what is wrong with the code?
I have a list of numbers in a file IDS.txt
10028615
1003
10096344
10100
10107393
10113978
10163178
118747520
I have a second File called src1src22.txt
From src:'1' To src:'22'
CHEMBL3549542 118747520
CHEMBL548732 44526300
CHEMBL1189709 11740251
CHEMBL405440 44297517
CHEMBL310280 10335685
expected newoutput.txt
CHEMBL3549542 118747520
I have written this code
while read line; do cat src1src22.txt | grep -i -w "$line" >> newoutput.txt done<IDS.txt
Your command line works - except you're missing a semicolon:
while read line; do grep -i -w "$line" src1src22.txt; done < IDS.txt >> newoutput.txt
I have found an efficient way to perform the task. Instead of a loop try this -f gives the pattern in the file next to it and searches in the next file. The chance of invalid character length which can occur with grep is reduced and looping slows the process down.
grep -iw -f IDS.txt src1src22.tx >>newoutput.txt
Try this -
awk 'NR==FNR{a[$2]=$1;next} $1 in a{print a[$1],$0}' f2 f1
CHEMBL3549542 118747520
Where f2 is src1src22.txt
I am trying to get a substring between &DEST= and the next & or a line break.
For example :
MYREQUESTISTO8764GETTHIS&DEST=SFO&ORIG=6546
In this I need to extract "SFO"
MYREQUESTISTO8764GETTHIS&DEST=SANFRANSISCO&ORIG=6546
In this I need to extract "SANFRANSISCO"
MYREQUESTISTO8764GETTHISWITH&DEST=SANJOSE
In this I need to extract "SANJOSE"
I am reading a file line by line, and I need to update the text after &DEST= and put it back in the file. The modification of the text is to mask the dest value with X character.
So, SFO should be replaced with XXX.
SANJOSE should be replaced with XXXXXXX.
Output :
MYREQUESTISTO8764GETTHIS&DEST=XXX&ORIG=6546
MYREQUESTISTO8764GETTHIS&DEST=XXXXXXXXXXXX&ORIG=6546
MYREQUESTISTO8764GETTHISWITH&DEST=XXXXXXX
Please let me know how to achieve this in script (Preferably shell or bash script).
Thanks.
$ cat file
MYREQUESTISTO8764GETTHIS&DEST=SFO&ORIG=6546
MYREQUESTISTO8764GETTHIS&DEST=PORTORICA
MYREQUESTISTO8764GETTHIS&DEST=SANFRANSISCO&ORIG=6546
MYREQUESTISTO8764GETTHISWITH&DEST=SANJOSE
$ sed -E 's/^.*&DEST=([^&]*)[&]*.*$/\1/' file
SFO
PORTORICA
SANFRANSISCO
SANJOSE
should do it
Replacing airports with an equal number of Xs
Let's consider this test file:
$ cat file
MYREQUESTISTO8764GETTHIS&DEST=SFO&ORIG=6546
MYREQUESTISTO8764GETTHIS&DEST=SANFRANSISCO&ORIG=6546
MYREQUESTISTO8764GETTHISWITH&DEST=SANJOSE
To replace the strings after &DEST= with an equal length of X and using GNU sed:
$ sed -E ':a; s/(&DEST=X*)[^X&]/\1X/; ta' file
MYREQUESTISTO8764GETTHIS&DEST=XXX&ORIG=6546
MYREQUESTISTO8764GETTHIS&DEST=XXXXXXXXXXXX&ORIG=6546
MYREQUESTISTO8764GETTHISWITH&DEST=XXXXXXX
To replace the file in-place:
sed -i -E ':a; s/(&DEST=X*)[^X&]/\1X/; ta' file
The above was tested with GNU sed. For BSD (OSX) sed, try:
sed -Ee :a -e 's/(&DEST=X*)[^X&]/\1X/' -e ta file
Or, to change in-place with BSD(OSX) sed, try:
sed -i '' -Ee :a -e 's/(&DEST=X*)[^X&]/\1X/' -e ta file
If there is some reason why it is important to use the shell to read the file line-by-line:
while IFS= read -r line
do
echo "$line" | sed -Ee :a -e 's/(&DEST=X*)[^X&]/\1X/' -e ta
done <file
How it works
Let's consider this code:
search_str="&DEST="
newfile=chart.txt
sed -E ':a; s/('"$search_str"'X*)[^X&]/\1X/; ta' "$newfile"
-E
This tells sed to use Extended Regular Expressions (ERE). This has the advantage of requiring fewer backslashes to escape things.
:a
This creates a label a.
s/('"$search_str"'X*)[^X&]/\1X/
This looks for $search_str followed by any number of X followed by any character that is not X or &. Because of the parens, everything except that last character is saved into group 1. This string is replaced by group 1, denoted \1 and an X.
ta
In sed, t is a test command. If the substitution was made (meaning that some character needed to be replaced by X), then the test evaluates to true and, in that case, ta tells sed to jump to label a.
This test-and-jump causes the substitution to be repeated as many times as necessary.
Replacing multiple tags with one sed command
$ name='DEST|ORIG'; sed -E ':a; s/(&('"$name"')=X*)[^X&]/\1X/; ta' file
MYREQUESTISTO8764GETTHIS&DEST=XXX&ORIG=XXXX
MYREQUESTISTO8764GETTHIS&DEST=XXXXXXXXXXXX&ORIG=XXXX
MYREQUESTISTO8764GETTHISWITH&DEST=XXXXXXX
Answer for original question
Using shell
$ s='MYREQUESTISTO8764GETTHIS&DEST=SFO&ORIG=6546'
$ s=${s#*&DEST=}
$ echo ${s%%&*}
SFO
How it works:
${s#*&DEST=} is prefix removal. This removes all text up to and including the first occurrence of &DEST=.
${s%%&*} is suffix removal_. It removes all text from the first & to the end of the string.
Using awk
$ echo 'MYREQUESTISTO8764GETTHIS&DEST=SFO&ORIG=6546' | awk -F'[=\n]' '$1=="DEST"{print $2}' RS='&'
SFO
How it works:
-F'[=\n]'
This tells awk to treat either an equal sign or a newline as the field separator
$1=="DEST"{print $2}
If the first field is DEST, then print the second field.
RS='&'
This sets the record separator to &.
With GNU bash:
while IFS= read -r line; do
[[ $line =~ (.*&DEST=)(.*)((&.*|$)) ]] && echo "${BASH_REMATCH[1]}fooooo${BASH_REMATCH[3]}"
done < file
Output:
MYREQUESTISTO8764GETTHIS&DEST=fooooo&ORIG=6546
MYREQUESTISTO8764GETTHIS&DEST=fooooo&ORIG=6546
MYREQUESTISTO8764GETTHISWITH&DEST=fooooo
Replace the characters between &DEST and & (or EOL) with x's:
awk -F'&DEST=' '{
printf("%s&DEST=", $1);
xlen=index($2,"&");
if ( xlen == 0) xlen=length($2)+1;
for (i=0;i<xlen;i++) printf("%s", "X");
endstr=substr($2,xlen);
printf("%s\n", endstr);
}' file
I'm trying to retrieve nth column from "busfile" file by substituting values in "i"
the below code works fine on redhat linux, when tried on hp unix i'm getting error
"sed: Function {i}{p} cannot be parsed."
here is my code
acList=/z/temp/busfile
i=1
temp1=`sed -n "{i}{p}" $acList`
echo $temp1
Update:
Even when I add the $ as suggested in some of the answers, I still have the same problem.
temp1=`sed -n "${i}{p}" $acList`
If you're trying to use the i variable to print a line, you need to precede it with $:
temp1=`sed -n "${i}p" $acList`
as per the following transcript:
pax> i=3
pax> echo 'a
...> b
...> c
...> d
...> e
...> f
...> g' | sed -n "${i}p"
c
In situations like this, I tend to first try the simplest solution then gradually add complexity until it fails.
The first step would be to create a four-line file (called myfile) with the words one through four:
one
two
three
four
then try various commands with it, in ever increasing complexity:
sed -n "p" myfile # Print all lines.
sed -n "3p" myfile # Print hard-coded line.
i=3 ; sed -n "${i}p" myfile # Print line with parameter.
i=3 ; x=`sed -n "${i}p" myfile` ; echo $x # Capture line with parameter.
At some point, it will hopefully "break" and you can then target your investigations in a more concentrated manner.
However, I suspect it's unnecessary here since your purported use of that command to extract a column is incorrect. If you're trying to print a column rather than a line, then awk may be a better tool for the job:
pax> i=5
pax> echo 'pax is a really great guy' | awk -vf=$i '{print $f}'
great
You can use:
acList=/z/temp/busfile
i=1
temp1=`sed -n $i'p' $acList`
echo "$temp1"