Related
I want to sort a huge array, say 10^8 entries of type X with at most N different keys, where N is ~10^2. Because I don't know the range or spacing of the elements, count sort is not an option. So my best guess so far is to use a hash map for the counts like so
std::unordered_map< X, unsigned > counts;
for (auto x : input)
counts[x]++;
This works ok-ish and is ~4 times faster than 3-way quicksort, but I'm a nervous person and it's still not fast enough.
I wonder: am I missing something? Can I make better use of the fact that N is known in advance? Or is it possible to tune the hash map to my needs?
EDIT An additional pre-condition is that the input sequence is badly sorted and the frequency of the keys is about the same.
STL implementations are often not perfect in terms of performance (no holy wars, please).
If you know a guaranteed and sensible upper on the number of unique elements (N), then you can trivially implement your own hash table of size 2^s >> N. Here is how I usually do it myself:
int size = 1;
while (size < 3 * N) size <<= 1;
//Note: at least 3X size factor, size = power of two
//count = -1 means empty entry
std::vector<std::pair<X, int>> table(size, make_pair(X(), -1));
auto GetHash = [size](X val) -> int { return std::hash<X>()(val) & (size-1); };
for (auto x : input) {
int cell = GetHash(x);
bool ok = false;
for (; table[cell].second >= 0; cell = (cell + 1) & (size-1)) {
if (table[cell].first == x) { //match found -> stop
ok = true;
break;
}
}
if (!ok) { //match not found -> add entry on free place
table[cell].first = x;
table[cell].second = 0;
}
table[cell].second++; //increment counter
}
On MSVC2013, it improves time from 0.62 secs to 0.52 secs compared to your code, given that int is used as type X.
Also, we can choose a faster hash function. Note however, that the choice of hash function depends heavily on the properties of the input. Let's take Knuth's multiplicative hash:
auto GetHash = [size](X val) -> int { return (val*2654435761) & (size-1); };
It further improves time to 0.34 secs.
As a conclusion: do you really want to reimplement standard data structures to achieve a 2X speed boost?
Notes: Speedup may be entirely different on another compiler/machine. You may have to do some hacks if your type X is not POD.
Counting sort really would by best, but isnt applicable due to unknown range or spacing.
Seems to be easily parallelized with fork-join, e.g. boost::thread.
You could also try a more efficient, handrolled hashmap. Unorded_map typically uses linked lists to counter potentially bad hash functions. The memory overhead of linked lists may hurt performance if the hashtable doesnt fit into L1 cache. Closed Hashing may use less memory. Some hints for optimizing:
Closed Hashing with linear probing and without support for removal
power of two sized hashtable for bit shifting instead of modulo (division requires multiple cycles and there is only one hardware divider per core)
Low LoadFactor (entries through size) to minimize collisions. Thats a tradeof between memory usage and number of collisions. A LoadFactor over 0.5 should be avoided. A hashtable-size of 256 seems suitable for 100 entries.
cheapo hash function. You havent shown the type of X, so perhaps a cheaper hash function could outweigh more collisions.
I would look to store items in a sorted vector, as about 100 keys, would mean inserting into the vector would only occur 1 in 10^6 entries. Lookup would be processor efficient bsearch in vector
I have been given this interview question:
Given an input file with four billion integers, provide an algorithm to generate an integer which is not contained in the file. Assume you have 1 GB memory. Follow up with what you would do if you have only 10 MB of memory.
My analysis:
The size of the file is 4×109×4 bytes = 16 GB.
We can do external sorting, thus letting us know the range of the integers.
My question is what is the best way to detect the missing integer in the sorted big integer sets?
My understanding (after reading all the answers):
Assuming we are talking about 32-bit integers, there are 232 = 4*109 distinct integers.
Case 1: we have 1 GB = 1 * 109 * 8 bits = 8 billion bits memory.
Solution:
If we use one bit representing one distinct integer, it is enough. we don't need sort.
Implementation:
int radix = 8;
byte[] bitfield = new byte[0xffffffff/radix];
void F() throws FileNotFoundException{
Scanner in = new Scanner(new FileReader("a.txt"));
while(in.hasNextInt()){
int n = in.nextInt();
bitfield[n/radix] |= (1 << (n%radix));
}
for(int i = 0; i< bitfield.lenght; i++){
for(int j =0; j<radix; j++){
if( (bitfield[i] & (1<<j)) == 0) System.out.print(i*radix+j);
}
}
}
Case 2: 10 MB memory = 10 * 106 * 8 bits = 80 million bits
Solution:
For all possible 16-bit prefixes, there are 216 number of
integers = 65536, we need 216 * 4 * 8 = 2 million bits. We need build 65536 buckets. For each bucket, we need 4 bytes holding all possibilities because the worst case is all the 4 billion integers belong to the same bucket.
Build the counter of each bucket through the first pass through the file.
Scan the buckets, find the first one who has less than 65536 hit.
Build new buckets whose high 16-bit prefixes are we found in step2
through second pass of the file
Scan the buckets built in step3, find the first bucket which doesnt
have a hit.
The code is very similar to above one.
Conclusion:
We decrease memory through increasing file pass.
A clarification for those arriving late: The question, as asked, does not say that there is exactly one integer that is not contained in the file—at least that's not how most people interpret it. Many comments in the comment thread are about that variation of the task, though. Unfortunately the comment that introduced it to the comment thread was later deleted by its author, so now it looks like the orphaned replies to it just misunderstood everything. It's very confusing, sorry.
Assuming that "integer" means 32 bits: 10 MB of space is more than enough for you to count how many numbers there are in the input file with any given 16-bit prefix, for all possible 16-bit prefixes in one pass through the input file. At least one of the buckets will have be hit less than 216 times. Do a second pass to find of which of the possible numbers in that bucket are used already.
If it means more than 32 bits, but still of bounded size: Do as above, ignoring all input numbers that happen to fall outside the (signed or unsigned; your choice) 32-bit range.
If "integer" means mathematical integer: Read through the input once and keep track of the largest number length of the longest number you've ever seen. When you're done, output the maximum plus one a random number that has one more digit. (One of the numbers in the file may be a bignum that takes more than 10 MB to represent exactly, but if the input is a file, then you can at least represent the length of anything that fits in it).
Statistically informed algorithms solve this problem using fewer passes than deterministic approaches.
If very large integers are allowed then one can generate a number that is likely to be unique in O(1) time. A pseudo-random 128-bit integer like a GUID will only collide with one of the existing four billion integers in the set in less than one out of every 64 billion billion billion cases.
If integers are limited to 32 bits then one can generate a number that is likely to be unique in a single pass using much less than 10 MB. The odds that a pseudo-random 32-bit integer will collide with one of the 4 billion existing integers is about 93% (4e9 / 2^32). The odds that 1000 pseudo-random integers will all collide is less than one in 12,000 billion billion billion (odds-of-one-collision ^ 1000). So if a program maintains a data structure containing 1000 pseudo-random candidates and iterates through the known integers, eliminating matches from the candidates, it is all but certain to find at least one integer that is not in the file.
A detailed discussion on this problem has been discussed in Jon Bentley "Column 1. Cracking the Oyster" Programming Pearls Addison-Wesley pp.3-10
Bentley discusses several approaches, including external sort, Merge Sort using several external files etc., But the best method Bentley suggests is a single pass algorithm using bit fields, which he humorously calls "Wonder Sort" :)
Coming to the problem, 4 billion numbers can be represented in :
4 billion bits = (4000000000 / 8) bytes = about 0.466 GB
The code to implement the bitset is simple: (taken from solutions page )
#define BITSPERWORD 32
#define SHIFT 5
#define MASK 0x1F
#define N 10000000
int a[1 + N/BITSPERWORD];
void set(int i) { a[i>>SHIFT] |= (1<<(i & MASK)); }
void clr(int i) { a[i>>SHIFT] &= ~(1<<(i & MASK)); }
int test(int i){ return a[i>>SHIFT] & (1<<(i & MASK)); }
Bentley's algorithm makes a single pass over the file, setting the appropriate bit in the array and then examines this array using test macro above to find the missing number.
If the available memory is less than 0.466 GB, Bentley suggests a k-pass algorithm, which divides the input into ranges depending on available memory. To take a very simple example, if only 1 byte (i.e memory to handle 8 numbers ) was available and the range was from 0 to 31, we divide this into ranges of 0 to 7, 8-15, 16-22 and so on and handle this range in each of 32/8 = 4 passes.
HTH.
Since the problem does not specify that we have to find the smallest possible number that is not in the file we could just generate a number that is longer than the input file itself. :)
For the 1 GB RAM variant you can use a bit vector. You need to allocate 4 billion bits == 500 MB byte array. For each number you read from the input, set the corresponding bit to '1'. Once you done, iterate over the bits, find the first one that is still '0'. Its index is the answer.
If they are 32-bit integers (likely from the choice of ~4 billion numbers close to 232), your list of 4 billion numbers will take up at most 93% of the possible integers (4 * 109 / (232) ). So if you create a bit-array of 232 bits with each bit initialized to zero (which will take up 229 bytes ~ 500 MB of RAM; remember a byte = 23 bits = 8 bits), read through your integer list and for each int set the corresponding bit-array element from 0 to 1; and then read through your bit-array and return the first bit that's still 0.
In the case where you have less RAM (~10 MB), this solution needs to be slightly modified. 10 MB ~ 83886080 bits is still enough to do a bit-array for all numbers between 0 and 83886079. So you could read through your list of ints; and only record #s that are between 0 and 83886079 in your bit array. If the numbers are randomly distributed; with overwhelming probability (it differs by 100% by about 10-2592069) you will find a missing int). In fact, if you only choose numbers 1 to 2048 (with only 256 bytes of RAM) you'd still find a missing number an overwhelming percentage (99.99999999999999999999999999999999999999999999999999999999999995%) of the time.
But let's say instead of having about 4 billion numbers; you had something like 232 - 1 numbers and less than 10 MB of RAM; so any small range of ints only has a small possibility of not containing the number.
If you were guaranteed that each int in the list was unique, you could sum the numbers and subtract the sum with one # missing to the full sum (½)(232)(232 - 1) = 9223372034707292160 to find the missing int. However, if an int occurred twice this method will fail.
However, you can always divide and conquer. A naive method, would be to read through the array and count the number of numbers that are in the first half (0 to 231-1) and second half (231, 232). Then pick the range with fewer numbers and repeat dividing that range in half. (Say if there were two less number in (231, 232) then your next search would count the numbers in the range (231, 3*230-1), (3*230, 232). Keep repeating until you find a range with zero numbers and you have your answer. Should take O(lg N) ~ 32 reads through the array.
That method was inefficient. We are only using two integers in each step (or about 8 bytes of RAM with a 4 byte (32-bit) integer). A better method would be to divide into sqrt(232) = 216 = 65536 bins, each with 65536 numbers in a bin. Each bin requires 4 bytes to store its count, so you need 218 bytes = 256 kB. So bin 0 is (0 to 65535=216-1), bin 1 is (216=65536 to 2*216-1=131071), bin 2 is (2*216=131072 to 3*216-1=196607). In python you'd have something like:
import numpy as np
nums_in_bin = np.zeros(65536, dtype=np.uint32)
for N in four_billion_int_array:
nums_in_bin[N // 65536] += 1
for bin_num, bin_count in enumerate(nums_in_bin):
if bin_count < 65536:
break # we have found an incomplete bin with missing ints (bin_num)
Read through the ~4 billion integer list; and count how many ints fall in each of the 216 bins and find an incomplete_bin that doesn't have all 65536 numbers. Then you read through the 4 billion integer list again; but this time only notice when integers are in that range; flipping a bit when you find them.
del nums_in_bin # allow gc to free old 256kB array
from bitarray import bitarray
my_bit_array = bitarray(65536) # 32 kB
my_bit_array.setall(0)
for N in four_billion_int_array:
if N // 65536 == bin_num:
my_bit_array[N % 65536] = 1
for i, bit in enumerate(my_bit_array):
if not bit:
print bin_num*65536 + i
break
Why make it so complicated? You ask for an integer not present in the file?
According to the rules specified, the only thing you need to store is the largest integer that you encountered so far in the file. Once the entire file has been read, return a number 1 greater than that.
There is no risk of hitting maxint or anything, because according to the rules, there is no restriction to the size of the integer or the number returned by the algorithm.
This can be solved in very little space using a variant of binary search.
Start off with the allowed range of numbers, 0 to 4294967295.
Calculate the midpoint.
Loop through the file, counting how many numbers were equal, less than or higher than the midpoint value.
If no numbers were equal, you're done. The midpoint number is the answer.
Otherwise, choose the range that had the fewest numbers and repeat from step 2 with this new range.
This will require up to 32 linear scans through the file, but it will only use a few bytes of memory for storing the range and the counts.
This is essentially the same as Henning's solution, except it uses two bins instead of 16k.
EDIT Ok, this wasn't quite thought through as it assumes the integers in the file follow some static distribution. Apparently they don't need to, but even then one should try this:
There are ≈4.3 billion 32-bit integers. We don't know how they are distributed in the file, but the worst case is the one with the highest Shannon entropy: an equal distribution. In this case, the probablity for any one integer to not occur in the file is
( (2³²-1)/2³² )⁴ ⁰⁰⁰ ⁰⁰⁰ ⁰⁰⁰ ≈ .4
The lower the Shannon entropy, the higher this probability gets on the average, but even for this worst case we have a chance of 90% to find a nonoccurring number after 5 guesses with random integers. Just create such numbers with a pseudorandom generator, store them in a list. Then read int after int and compare it to all of your guesses. When there's a match, remove this list entry. After having been through all of the file, chances are you will have more than one guess left. Use any of them. In the rare (10% even at worst case) event of no guess remaining, get a new set of random integers, perhaps more this time (10->99%).
Memory consumption: a few dozen bytes, complexity: O(n), overhead: neclectable as most of the time will be spent in the unavoidable hard disk accesses rather than comparing ints anyway.
The actual worst case, when we do not assume a static distribution, is that every integer occurs max. once, because then only
1 - 4000000000/2³² ≈ 6%
of all integers don't occur in the file. So you'll need some more guesses, but that still won't cost hurtful amounts of memory.
If you have one integer missing from the range [0, 2^x - 1] then just xor them all together. For example:
>>> 0 ^ 1 ^ 3
2
>>> 0 ^ 1 ^ 2 ^ 3 ^ 4 ^ 6 ^ 7
5
(I know this doesn't answer the question exactly, but it's a good answer to a very similar question.)
They may be looking to see if you have heard of a probabilistic Bloom Filter which can very efficiently determine absolutely if a value is not part of a large set, (but can only determine with high probability it is a member of the set.)
Based on the current wording in the original question, the simplest solution is:
Find the maximum value in the file, then add 1 to it.
Use a BitSet. 4 billion integers (assuming up to 2^32 integers) packed into a BitSet at 8 per byte is 2^32 / 2^3 = 2^29 = approx 0.5 Gb.
To add a bit more detail - every time you read a number, set the corresponding bit in the BitSet. Then, do a pass over the BitSet to find the first number that's not present. In fact, you could do this just as effectively by repeatedly picking a random number and testing if it's present.
Actually BitSet.nextClearBit(0) will tell you the first non-set bit.
Looking at the BitSet API, it appears to only support 0..MAX_INT, so you may need 2 BitSets - one for +'ve numbers and one for -'ve numbers - but the memory requirements don't change.
If there is no size limit, the quickest way is to take the length of the file, and generate the length of the file+1 number of random digits (or just "11111..." s). Advantage: you don't even need to read the file, and you can minimize memory use nearly to zero. Disadvantage: You will print billions of digits.
However, if the only factor was minimizing memory usage, and nothing else is important, this would be the optimal solution. It might even get you a "worst abuse of the rules" award.
If we assume that the range of numbers will always be 2^n (an even power of 2), then exclusive-or will work (as shown by another poster). As far as why, let's prove it:
The Theory
Given any 0 based range of integers that has 2^n elements with one element missing, you can find that missing element by simply xor-ing the known values together to yield the missing number.
The Proof
Let's look at n = 2. For n=2, we can represent 4 unique integers: 0, 1, 2, 3. They have a bit pattern of:
0 - 00
1 - 01
2 - 10
3 - 11
Now, if we look, each and every bit is set exactly twice. Therefore, since it is set an even number of times, and exclusive-or of the numbers will yield 0. If a single number is missing, the exclusive-or will yield a number that when exclusive-ored with the missing number will result in 0. Therefore, the missing number, and the resulting exclusive-ored number are exactly the same. If we remove 2, the resulting xor will be 10 (or 2).
Now, let's look at n+1. Let's call the number of times each bit is set in n, x and the number of times each bit is set in n+1 y. The value of y will be equal to y = x * 2 because there are x elements with the n+1 bit set to 0, and x elements with the n+1 bit set to 1. And since 2x will always be even, n+1 will always have each bit set an even number of times.
Therefore, since n=2 works, and n+1 works, the xor method will work for all values of n>=2.
The Algorithm For 0 Based Ranges
This is quite simple. It uses 2*n bits of memory, so for any range <= 32, 2 32 bit integers will work (ignoring any memory consumed by the file descriptor). And it makes a single pass of the file.
long supplied = 0;
long result = 0;
while (supplied = read_int_from_file()) {
result = result ^ supplied;
}
return result;
The Algorithm For Arbitrary Based Ranges
This algorithm will work for ranges of any starting number to any ending number, as long as the total range is equal to 2^n... This basically re-bases the range to have the minimum at 0. But it does require 2 passes through the file (the first to grab the minimum, the second to compute the missing int).
long supplied = 0;
long result = 0;
long offset = INT_MAX;
while (supplied = read_int_from_file()) {
if (supplied < offset) {
offset = supplied;
}
}
reset_file_pointer();
while (supplied = read_int_from_file()) {
result = result ^ (supplied - offset);
}
return result + offset;
Arbitrary Ranges
We can apply this modified method to a set of arbitrary ranges, since all ranges will cross a power of 2^n at least once. This works only if there is a single missing bit. It takes 2 passes of an unsorted file, but it will find the single missing number every time:
long supplied = 0;
long result = 0;
long offset = INT_MAX;
long n = 0;
double temp;
while (supplied = read_int_from_file()) {
if (supplied < offset) {
offset = supplied;
}
}
reset_file_pointer();
while (supplied = read_int_from_file()) {
n++;
result = result ^ (supplied - offset);
}
// We need to increment n one value so that we take care of the missing
// int value
n++
while (n == 1 || 0 != (n & (n - 1))) {
result = result ^ (n++);
}
return result + offset;
Basically, re-bases the range around 0. Then, it counts the number of unsorted values to append as it computes the exclusive-or. Then, it adds 1 to the count of unsorted values to take care of the missing value (count the missing one). Then, keep xoring the n value, incremented by 1 each time until n is a power of 2. The result is then re-based back to the original base. Done.
Here's the algorithm I tested in PHP (using an array instead of a file, but same concept):
function find($array) {
$offset = min($array);
$n = 0;
$result = 0;
foreach ($array as $value) {
$result = $result ^ ($value - $offset);
$n++;
}
$n++; // This takes care of the missing value
while ($n == 1 || 0 != ($n & ($n - 1))) {
$result = $result ^ ($n++);
}
return $result + $offset;
}
Fed in an array with any range of values (I tested including negatives) with one inside that range which is missing, it found the correct value each time.
Another Approach
Since we can use external sorting, why not just check for a gap? If we assume the file is sorted prior to the running of this algorithm:
long supplied = 0;
long last = read_int_from_file();
while (supplied = read_int_from_file()) {
if (supplied != last + 1) {
return last + 1;
}
last = supplied;
}
// The range is contiguous, so what do we do here? Let's return last + 1:
return last + 1;
Trick question, unless it's been quoted improperly. Just read through the file once to get the maximum integer n, and return n+1.
Of course you'd need a backup plan in case n+1 causes an integer overflow.
Check the size of the input file, then output any number which is too large to be represented by a file that size. This may seem like a cheap trick, but it's a creative solution to an interview problem, it neatly sidesteps the memory issue, and it's technically O(n).
void maxNum(ulong filesize)
{
ulong bitcount = filesize * 8; //number of bits in file
for (ulong i = 0; i < bitcount; i++)
{
Console.Write(9);
}
}
Should print 10 bitcount - 1, which will always be greater than 2 bitcount. Technically, the number you have to beat is 2 bitcount - (4 * 109 - 1), since you know there are (4 billion - 1) other integers in the file, and even with perfect compression they'll take up at least one bit each.
The simplest approach is to find the minimum number in the file, and return 1 less than that. This uses O(1) storage, and O(n) time for a file of n numbers. However, it will fail if number range is limited, which could make min-1 not-a-number.
The simple and straightforward method of using a bitmap has already been mentioned. That method uses O(n) time and storage.
A 2-pass method with 2^16 counting-buckets has also been mentioned. It reads 2*n integers, so uses O(n) time and O(1) storage, but it cannot handle datasets with more than 2^16 numbers. However, it's easily extended to (eg) 2^60 64-bit integers by running 4 passes instead of 2, and easily adapted to using tiny memory by using only as many bins as fit in memory and increasing the number of passes correspondingly, in which case run time is no longer O(n) but instead is O(n*log n).
The method of XOR'ing all the numbers together, mentioned so far by rfrankel and at length by ircmaxell answers the question asked in stackoverflow#35185, as ltn100 pointed out. It uses O(1) storage and O(n) run time. If for the moment we assume 32-bit integers, XOR has a 7% probability of producing a distinct number. Rationale: given ~ 4G distinct numbers XOR'd together, and ca. 300M not in file, the number of set bits in each bit position has equal chance of being odd or even. Thus, 2^32 numbers have equal likelihood of arising as the XOR result, of which 93% are already in file. Note that if the numbers in file aren't all distinct, the XOR method's probability of success rises.
Strip the white space and non numeric characters from the file and append 1. Your file now contains a single number not listed in the original file.
From Reddit by Carbonetc.
For some reason, as soon as I read this problem I thought of diagonalization. I'm assuming arbitrarily large integers.
Read the first number. Left-pad it with zero bits until you have 4 billion bits. If the first (high-order) bit is 0, output 1; else output 0. (You don't really have to left-pad: you just output a 1 if there are not enough bits in the number.) Do the same with the second number, except use its second bit. Continue through the file in this way. You will output a 4-billion bit number one bit at a time, and that number will not be the same as any in the file. Proof: it were the same as the nth number, then they would agree on the nth bit, but they don't by construction.
You can use bit flags to mark whether an integer is present or not.
After traversing the entire file, scan each bit to determine if the number exists or not.
Assuming each integer is 32 bit, they will conveniently fit in 1 GB of RAM if bit flagging is done.
Just for the sake of completeness, here is another very simple solution, which will most likely take a very long time to run, but uses very little memory.
Let all possible integers be the range from int_min to int_max, and
bool isNotInFile(integer) a function which returns true if the file does not contain a certain integer and false else (by comparing that certain integer with each integer in the file)
for (integer i = int_min; i <= int_max; ++i)
{
if (isNotInFile(i)) {
return i;
}
}
For the 10 MB memory constraint:
Convert the number to its binary representation.
Create a binary tree where left = 0 and right = 1.
Insert each number in the tree using its binary representation.
If a number has already been inserted, the leafs will already have been created.
When finished, just take a path that has not been created before to create the requested number.
4 billion number = 2^32, meaning 10 MB might not be sufficient.
EDIT
An optimization is possible, if two ends leafs have been created and have a common parent, then they can be removed and the parent flagged as not a solution. This cuts branches and reduces the need for memory.
EDIT II
There is no need to build the tree completely too. You only need to build deep branches if numbers are similar. If we cut branches too, then this solution might work in fact.
I will answer the 1 GB version:
There is not enough information in the question, so I will state some assumptions first:
The integer is 32 bits with range -2,147,483,648 to 2,147,483,647.
Pseudo-code:
var bitArray = new bit[4294967296]; // 0.5 GB, initialized to all 0s.
foreach (var number in file) {
bitArray[number + 2147483648] = 1; // Shift all numbers so they start at 0.
}
for (var i = 0; i < 4294967296; i++) {
if (bitArray[i] == 0) {
return i - 2147483648;
}
}
As long as we're doing creative answers, here is another one.
Use the external sort program to sort the input file numerically. This will work for any amount of memory you may have (it will use file storage if needed).
Read through the sorted file and output the first number that is missing.
Bit Elimination
One way is to eliminate bits, however this might not actually yield a result (chances are it won't). Psuedocode:
long val = 0xFFFFFFFFFFFFFFFF; // (all bits set)
foreach long fileVal in file
{
val = val & ~fileVal;
if (val == 0) error;
}
Bit Counts
Keep track of the bit counts; and use the bits with the least amounts to generate a value. Again this has no guarantee of generating a correct value.
Range Logic
Keep track of a list ordered ranges (ordered by start). A range is defined by the structure:
struct Range
{
long Start, End; // Inclusive.
}
Range startRange = new Range { Start = 0x0, End = 0xFFFFFFFFFFFFFFFF };
Go through each value in the file and try and remove it from the current range. This method has no memory guarantees, but it should do pretty well.
2128*1018 + 1 ( which is (28)16*1018 + 1 ) - cannot it be a universal answer for today? This represents a number that cannot be held in 16 EB file, which is the maximum file size in any current file system.
I think this is a solved problem (see above), but there's an interesting side case to keep in mind because it might get asked:
If there are exactly 4,294,967,295 (2^32 - 1) 32-bit integers with no repeats, and therefore only one is missing, there is a simple solution.
Start a running total at zero, and for each integer in the file, add that integer with 32-bit overflow (effectively, runningTotal = (runningTotal + nextInteger) % 4294967296). Once complete, add 4294967296/2 to the running total, again with 32-bit overflow. Subtract this from 4294967296, and the result is the missing integer.
The "only one missing integer" problem is solvable with only one run, and only 64 bits of RAM dedicated to the data (32 for the running total, 32 to read in the next integer).
Corollary: The more general specification is extremely simple to match if we aren't concerned with how many bits the integer result must have. We just generate a big enough integer that it cannot be contained in the file we're given. Again, this takes up absolutely minimal RAM. See the pseudocode.
# Grab the file size
fseek(fp, 0L, SEEK_END);
sz = ftell(fp);
# Print a '2' for every bit of the file.
for (c=0; c<sz; c++) {
for (b=0; b<4; b++) {
print "2";
}
}
As Ryan said it basically, sort the file and then go over the integers and when a value is skipped there you have it :)
EDIT at downvoters: the OP mentioned that the file could be sorted so this is a valid method.
If you don't assume the 32-bit constraint, just return a randomly generated 64-bit number (or 128-bit if you're a pessimist). The chance of collision is 1 in 2^64/(4*10^9) = 4611686018.4 (roughly 1 in 4 billion). You'd be right most of the time!
(Joking... kind of.)
There is a file that contains 10G(1000000000) number of integers, please find the Median of these integers. you are given 2G memory to do this. Can anyone come up with an reasonable way? thanks!
Create an array of 8-byte longs that has 2^16 entries. Take your input numbers, shift off the bottom sixteen bits, and create a histogram.
Now you count up in that histogram until you reach the bin that covers the midpoint of the values.
Pass through again, ignoring all numbers that don't have that same set of top bits, and make a histogram of the bottom bits.
Count up through that histogram until you reach the bin that covers the midpoint of the (entire list of) values.
Now you know the median, in O(n) time and O(1) space (in practice, under 1 MB).
Here's some sample Scala code that does this:
def medianFinder(numbers: Iterable[Int]) = {
def midArgMid(a: Array[Long], mid: Long) = {
val cuml = a.scanLeft(0L)(_ + _).drop(1)
cuml.zipWithIndex.dropWhile(_._1 < mid).head
}
val topHistogram = new Array[Long](65536)
var count = 0L
numbers.foreach(number => {
count += 1
topHistogram(number>>>16) += 1
})
val (topCount,topIndex) = midArgMid(topHistogram, (count+1)/2)
val botHistogram = new Array[Long](65536)
numbers.foreach(number => {
if ((number>>>16) == topIndex) botHistogram(number & 0xFFFF) += 1
})
val (botCount,botIndex) =
midArgMid(botHistogram, (count+1)/2 - (topCount-topHistogram(topIndex)))
(topIndex<<16) + botIndex
}
and here it is working on a small set of input data:
scala> medianFinder(List(1,123,12345,1234567,123456789))
res18: Int = 12345
If you have 64 bit integers stored, you can use the same strategy in 4 passes instead.
You can use the Medians of Medians algorithm.
If the file is in text format, you may be able to fit it in memory just by converting things to integers as you read them in, since an integer stored as characters may take more space than an integer stored as an integer, depending on the size of the integers and the type of text file. EDIT: You edited your original question; I can see now that you can't read them into memory, see below.
If you can't read them into memory, this is what I came up with:
Figure out how many integers you have. You may know this from the start. If not, then it only takes one pass through the file. Let's say this is S.
Use your 2G of memory to find the x largest integers (however many you can fit). You can do one pass through the file, keeping the x largest in a sorted list of some sort, discarding the rest as you go. Now you know the x-th largest integer. You can discard all of these except for the x-th largest, which I'll call x1.
Do another pass through, finding the next x largest integers less than x1, the least of which is x2.
I think you can see where I'm going with this. After a few passes, you will have read in the (S/2)-th largest integer (you'll have to keep track of how many integers you've found), which is your median. If S is even then you'll average the two in the middle.
Make a pass through the file and find count of integers and minimum and maximum integer value.
Take midpoint of min and max, and get count, min and max for values either side of the midpoint - by again reading through the file.
partition count > count => median lies within that partition.
Repeat for the partition, taking into account size of 'partitions to the left' (easy to maintain), and also watching for min = max.
Am sure this'd work for an arbitrary number of partitions as well.
Do an on-disk external mergesort on the file to sort the integers (counting them if that's not already known).
Once the file is sorted, seek to the middle number (odd case), or average the two middle numbers (even case) in the file to get the median.
The amount of memory used is adjustable and unaffected by the number of integers in the original file. One caveat of the external sort is that the intermediate sorting data needs to be written to disk.
Given n = number of integers in the original file:
Running time: O(nlogn)
Memory: O(1), adjustable
Disk: O(n)
Check out Torben's method in here:http://ndevilla.free.fr/median/median/index.html. It also has implementation in C at the bottom of the document.
My best guess that probabilistic median of medians would be the fastest one. Recipe:
Take next set of N integers (N should be big enough, say 1000 or 10000 elements)
Then calculate median of these integers and assign it to variable X_new.
If iteration is not first - calculate median of two medians:
X_global = (X_global + X_new) / 2
When you will see that X_global fluctuates not much - this means that you found approximate median of data.
But there some notes :
question arises - Is median error acceptable or not.
integers must be distributed randomly in a uniform way, for solution to work
EDIT:
I've played a bit with this algorithm, changed a bit idea - in each iteration we should sum X_new with decreasing weight, such as:
X_global = k*X_global + (1.-k)*X_new :
k from [0.5 .. 1.], and increases in each iteration.
Point is to make calculation of median to converge fast to some number in very small amount of iterations. So that very approximate median (with big error) is found between 100000000 array elements in only 252 iterations !!! Check this C experiment:
#include <stdlib.h>
#include <stdio.h>
#include <time.h>
#define ARRAY_SIZE 100000000
#define RANGE_SIZE 1000
// probabilistic median of medians method
// should print 5000 as data average
// from ARRAY_SIZE of elements
int main (int argc, const char * argv[]) {
int iter = 0;
int X_global = 0;
int X_new = 0;
int i = 0;
float dk = 0.002;
float k = 0.5;
srand(time(NULL));
while (i<ARRAY_SIZE && k!=1.) {
X_new=0;
for (int j=i; j<i+RANGE_SIZE; j++) {
X_new+=rand()%10000 + 1;
}
X_new/=RANGE_SIZE;
if (iter>0) {
k += dk;
k = (k>1.)? 1.:k;
X_global = k*X_global+(1.-k)*X_new;
}
else {
X_global = X_new;
}
i+=RANGE_SIZE+1;
iter++;
printf("iter %d, median = %d \n",iter,X_global);
}
return 0;
}
Opps seems i'm talking about mean, not median. If it is so, and you need exactly median, not mean - ignore my post. In any case mean and median are very related concepts.
Good luck.
Here is the algorithm described by #Rex Kerr implemented in Java.
/**
* Computes the median.
* #param arr Array of strings, each element represents a distinct binary number and has the same number of bits (padded with leading zeroes if necessary)
* #return the median (number of rank ceil((m+1)/2) ) of the array as a string
*/
static String computeMedian(String[] arr) {
// rank of the median element
int m = (int) Math.ceil((arr.length+1)/2.0);
String bitMask = "";
int zeroBin = 0;
while (bitMask.length() < arr[0].length()) {
// puts elements which conform to the bitMask into one of two buckets
for (String curr : arr) {
if (curr.startsWith(bitMask))
if (curr.charAt(bitMask.length()) == '0')
zeroBin++;
}
// decides in which bucket the median is located
if (zeroBin >= m)
bitMask = bitMask.concat("0");
else {
m -= zeroBin;
bitMask = bitMask.concat("1");
}
zeroBin = 0;
}
return bitMask;
}
Some test cases and updates to the algorithm can be found here.
I was also asked the same question and i couldn't tell an exact answer so after the interview i went through some books on interviews and here is what i found from Cracking The Coding interview book.
Example: Numbers are randomly generated and stored into an (expanding) array. How
wouldyoukeep track of the median?
Our data structure brainstorm might look like the following:
• Linked list? Probably not. Linked lists tend not to do very well with accessing and
sorting numbers.
• Array? Maybe, but you already have an array. Could you somehow keep the elements
sorted? That's probably expensive. Let's hold off on this and return to it if it's needed.
• Binary tree? This is possible, since binary trees do fairly well with ordering. In fact, if the binary search tree is perfectly balanced, the top might be the median. But, be careful—if there's an even number of elements, the median is actually the average
of the middle two elements. The middle two elements can't both be at the top. This is probably a workable algorithm, but let's come back to it.
• Heap? A heap is really good at basic ordering and keeping track of max and mins.
This is actually interesting—if you had two heaps, you could keep track of the bigger
half and the smaller half of the elements. The bigger half is kept in a min heap, such
that the smallest element in the bigger half is at the root.The smaller half is kept in a
max heap, such that the biggest element of the smaller half is at the root. Now, with
these data structures, you have the potential median elements at the roots. If the
heaps are no longer the same size, you can quickly "rebalance" the heaps by popping
an element off the one heap and pushing it onto the other.
Note that the more problems you do, the more developed your instinct on which data
structure to apply will be. You will also develop a more finely tuned instinct as to which of these approaches is the most useful.
I would like to randomly iterate through a range. Each value will be visited only once and all values will eventually be visited. For example:
class Array
def shuffle
ret = dup
j = length
i = 0
while j > 1
r = i + rand(j)
ret[i], ret[r] = ret[r], ret[i]
i += 1
j -= 1
end
ret
end
end
(0..9).to_a.shuffle.each{|x| f(x)}
where f(x) is some function that operates on each value. A Fisher-Yates shuffle is used to efficiently provide random ordering.
My problem is that shuffle needs to operate on an array, which is not cool because I am working with astronomically large numbers. Ruby will quickly consume a large amount of RAM trying to create a monstrous array. Imagine replacing (0..9) with (0..99**99). This is also why the following code will not work:
tried = {} # store previous attempts
bigint = 99**99
bigint.times {
x = rand(bigint)
redo if tried[x]
tried[x] = true
f(x) # some function
}
This code is very naive and quickly runs out of memory as tried obtains more entries.
What sort of algorithm can accomplish what I am trying to do?
[Edit1]: Why do I want to do this? I'm trying to exhaust the search space of a hash algorithm for a N-length input string looking for partial collisions. Each number I generate is equivalent to a unique input string, entropy and all. Basically, I'm "counting" using a custom alphabet.
[Edit2]: This means that f(x) in the above examples is a method that generates a hash and compares it to a constant, target hash for partial collisions. I do not need to store the value of x after I call f(x) so memory should remain constant over time.
[Edit3/4/5/6]: Further clarification/fixes.
[Solution]: The following code is based on #bta's solution. For the sake of conciseness, next_prime is not shown. It produces acceptable randomness and only visits each number once. See the actual post for more details.
N = size_of_range
Q = ( 2 * N / (1 + Math.sqrt(5)) ).to_i.next_prime
START = rand(N)
x = START
nil until f( x = (x + Q) % N ) == START # assuming f(x) returns x
I just remembered a similar problem from a class I took years ago; that is, iterating (relatively) randomly through a set (completely exhausting it) given extremely tight memory constraints. If I'm remembering this correctly, our solution algorithm was something like this:
Define the range to be from 0 to
some number N
Generate a random starting point x[0] inside N
Generate an iterator Q less than N
Generate successive points x[n] by adding Q to
the previous point and wrapping around if needed. That
is, x[n+1] = (x[n] + Q) % N
Repeat until you generate a new point equal to the starting point.
The trick is to find an iterator that will let you traverse the entire range without generating the same value twice. If I'm remembering correctly, any relatively prime N and Q will work (the closer the number to the bounds of the range the less 'random' the input). In that case, a prime number that is not a factor of N should work. You can also swap bytes/nibbles in the resulting number to change the pattern with which the generated points "jump around" in N.
This algorithm only requires the starting point (x[0]), the current point (x[n]), the iterator value (Q), and the range limit (N) to be stored.
Perhaps someone else remembers this algorithm and can verify if I'm remembering it correctly?
As #Turtle answered, you problem doesn't have a solution. #KandadaBoggu and #bta solution gives you random numbers is some ranges which are or are not random. You get clusters of numbers.
But I don't know why you care about double occurence of the same number. If (0..99**99) is your range, then if you could generate 10^10 random numbers per second (if you have a 3 GHz processor and about 4 cores on which you generate one random number per CPU cycle - which is imposible, and ruby will even slow it down a lot), then it would take about 10^180 years to exhaust all the numbers. You have also probability about 10^-180 that two identical numbers will be generated during a whole year. Our universe has probably about 10^9 years, so if your computer could start calculation when the time began, then you would have probability about 10^-170 that two identical numbers were generated. In the other words - practicaly it is imposible and you don't have to care about it.
Even if you would use Jaguar (top 1 from www.top500.org supercomputers) with only this one task, you still need 10^174 years to get all numbers.
If you don't belive me, try
tried = {} # store previous attempts
bigint = 99**99
bigint.times {
x = rand(bigint)
puts "Oh, no!" if tried[x]
tried[x] = true
}
I'll buy you a beer if you will even once see "Oh, no!" on your screen during your life time :)
I could be wrong, but I don't think this is doable without storing some state. At the very least, you're going to need some state.
Even if you only use one bit per value (has this value been tried yes or no) then you will need X/8 bytes of memory to store the result (where X is the largest number). Assuming that you have 2GB of free memory, this would leave you with more than 16 million numbers.
Break the range in to manageable batches as shown below:
def range_walker range, batch_size = 100
size = (range.end - range.begin) + 1
n = size/batch_size
n.times do |i|
x = i * batch_size + range.begin
y = x + batch_size
(x...y).sort_by{rand}.each{|z| p z}
end
d = (range.end - size%batch_size + 1)
(d..range.end).sort_by{rand}.each{|z| p z }
end
You can further randomize solution by randomly choosing the batch for processing.
PS: This is a good problem for map-reduce. Each batch can be worked by independent nodes.
Reference:
Map-reduce in Ruby
you can randomly iterate an array with shuffle method
a = [1,2,3,4,5,6,7,8,9]
a.shuffle!
=> [5, 2, 8, 7, 3, 1, 6, 4, 9]
You want what's called a "full cycle iterator"...
Here is psudocode for the simplest version which is perfect for most uses...
function fullCycleStep(sample_size, last_value, random_seed = 31337, prime_number = 32452843) {
if last_value = null then last_value = random_seed % sample_size
return (last_value + prime_number) % sample_size
}
If you call this like so:
sample = 10
For i = 1 to sample
last_value = fullCycleStep(sample, last_value)
print last_value
next
It would generate random numbers, looping through all 10, never repeating If you change random_seed, which can be anything, or prime_number, which must be greater than, and not be evenly divisible by sample_size, you will get a new random order, but you will still never get a duplicate.
Database systems and other large-scale systems do this by writing the intermediate results of recursive sorts to a temp database file. That way, they can sort massive numbers of records while only keeping limited numbers of records in memory at any one time. This tends to be complicated in practice.
How "random" does your order have to be? If you don't need a specific input distribution, you could try a recursive scheme like this to minimize memory usage:
def gen_random_indices
# Assume your input range is (0..(10**3))
(0..3).sort_by{rand}.each do |a|
(0..3).sort_by{rand}.each do |b|
(0..3).sort_by{rand}.each do |c|
yield "#{a}#{b}#{c}".to_i
end
end
end
end
gen_random_indices do |idx|
run_test_with_index(idx)
end
Essentially, you are constructing the index by randomly generating one digit at a time. In the worst-case scenario, this will require enough memory to store 10 * (number of digits). You will encounter every number in the range (0..(10**3)) exactly once, but the order is only pseudo-random. That is, if the first loop sets a=1, then you will encounter all three-digit numbers of the form 1xx before you see the hundreds digit change.
The other downside is the need to manually construct the function to a specified depth. In your (0..(99**99)) case, this would likely be a problem (although I suppose you could write a script to generate the code for you). I'm sure there's probably a way to re-write this in a state-ful, recursive manner, but I can't think of it off the top of my head (ideas, anyone?).
[Edit]: Taking into account #klew and #Turtle's answers, the best I can hope for is batches of random (or close to random) numbers.
This is a recursive implementation of something similar to KandadaBoggu's solution. Basically, the search space (as a range) is partitioned into an array containing N equal-sized ranges. Each range is fed back in a random order as a new search space. This continues until the size of the range hits a lower bound. At this point the range is small enough to be converted into an array, shuffled, and checked.
Even though it is recursive, I haven't blown the stack yet. Instead, it errors out when attempting to partition a search space larger than about 10^19 keys. I has to do with the numbers being too large to convert to a long. It can probably be fixed:
# partition a range into an array of N equal-sized ranges
def partition(range, n)
ranges = []
first = range.first
last = range.last
length = last - first + 1
step = length / n # integer division
((first + step - 1)..last).step(step) { |i|
ranges << (first..i)
first = i + 1
}
# append any extra onto the last element
ranges[-1] = (ranges[-1].first)..last if last > step * ranges.length
ranges
end
I hope the code comments help shed some light on my original question.
pastebin: full source
Note: PW_LEN under # options can be changed to a lower number in order to get quicker results.
For a prohibitively large space, like
space = -10..1000000000000000000000
You can add this method to Range.
class Range
M127 = 170_141_183_460_469_231_731_687_303_715_884_105_727
def each_random(seed = 0)
return to_enum(__method__) { size } unless block_given?
unless first.kind_of? Integer
raise TypeError, "can't randomly iterate from #{first.class}"
end
sample_size = self.end - first + 1
sample_size -= 1 if exclude_end?
j = coprime sample_size
v = seed % sample_size
each do
v = (v + j) % sample_size
yield first + v
end
end
protected
def gcd(a,b)
b == 0 ? a : gcd(b, a % b)
end
def coprime(a, z = M127)
gcd(a, z) == 1 ? z : coprime(a, z + 1)
end
end
You could then
space.each_random { |i| puts i }
729815750697818944176
459631501395637888351
189447252093456832526
919263002791275776712
649078753489094720887
378894504186913665062
108710254884732609237
838526005582551553423
568341756280370497598
298157506978189441773
27973257676008385948
757789008373827330134
487604759071646274309
217420509769465218484
947236260467284162670
677052011165103106845
406867761862922051020
136683512560740995195
866499263258559939381
596315013956378883556
326130764654197827731
55946515352016771906
785762266049835716092
515578016747654660267
...
With a good amount of randomness so long as your space is a few orders smaller than M127.
Credit to #nick-steele and #bta for the approach.
This isn't really a Ruby-specific answer but I hope it's permitted. Andrew Kensler gives a C++ "permute()" function that does exactly this in his "Correlated Multi-Jittered Sampling" report.
As I understand it, the exact function he provides really only works if your "array" is up to size 2^27, but the general idea could be used for arrays of any size.
I'll do my best to sort of explain it. The first part is you need a hash that is reversible "for any power-of-two sized domain". Consider x = i + 1. No matter what x is, even if your integer overflows, you can determine what i was. More specifically, you can always determine the bottom n-bits of i from the bottom n-bits of x. Addition is a reversible hash operation, as is multiplication by an odd number, as is doing a bitwise xor by a constant. If you know a specific power-of-two domain, you can scramble bits in that domain. E.g. x ^= (x & 0xFF) >> 5) is valid for the 16-bit domain. You can specify that domain with a mask, e.g. mask = 0xFF, and your hash function becomes x = hash(i, mask). Of course you can add a "seed" value into that hash function to get different randomizations. Kensler lays out more valid operations in the paper.
So you have a reversible function x = hash(i, mask, seed). The problem is that if you hash your index, you might end up with a value that is larger than your array size, i.e. your "domain". You can't just modulo this or you'll get collisions.
The reversible hash is the key to using a technique called "cycle walking", introduced in "Ciphers with Arbitrary Finite Domains". Because the hash is reversible (i.e. 1-to-1), you can just repeatedly apply the same hash until your hashed value is smaller than your array! Because you're applying the same hash, and the mapping is one-to-one, whatever value you end up on will map back to exactly one index, so you don't have collisions. So your function could look something like this for 32-bit integers (pseudocode):
fun permute(i, length, seed) {
i = hash(i, 0xFFFF, seed)
while(i >= length): i = hash(i, 0xFFFF, seed)
return i
}
It could take a lot of hashes to get to your domain, so Kensler does a simple trick: he keeps the hash within the domain of the next power of two, which makes it require very few iterations (~2 on average), by masking out the unnecessary bits. The final algorithm looks like this:
fun next_pow_2(length) {
# This implementation is for clarity.
# See Kensler's paper for one way to do it fast.
p = 1
while (p < length): p *= 2
return p
}
permute(i, length, seed) {
mask = next_pow_2(length)-1
i = hash(i, mask, seed) & mask
while(i >= length): i = hash(i, mask, seed) & mask
return i
}
And that's it! Obviously the important thing here is choosing a good hash function, which Kensler provides in the paper but I wanted to break down the explanation. If you want to have different random permutations each time, you can add a "seed" value to the permute function which then gets passed to the hash function.
This is a long text. Please bear with me. Boiled down, the question is: Is there a workable in-place radix sort algorithm?
Preliminary
I've got a huge number of small fixed-length strings that only use the letters “A”, “C”, “G” and “T” (yes, you've guessed it: DNA) that I want to sort.
At the moment, I use std::sort which uses introsort in all common implementations of the STL. This works quite well. However, I'm convinced that radix sort fits my problem set perfectly and should work much better in practice.
Details
I've tested this assumption with a very naive implementation and for relatively small inputs (on the order of 10,000) this was true (well, at least more than twice as fast). However, runtime degrades abysmally when the problem size becomes larger (N > 5,000,000).
The reason is obvious: radix sort requires copying the whole data (more than once in my naive implementation, actually). This means that I've put ~ 4 GiB into my main memory which obviously kills performance. Even if it didn't, I can't afford to use this much memory since the problem sizes actually become even larger.
Use Cases
Ideally, this algorithm should work with any string length between 2 and 100, for DNA as well as DNA5 (which allows an additional wildcard character “N”), or even DNA with IUPAC ambiguity codes (resulting in 16 distinct values). However, I realize that all these cases cannot be covered, so I'm happy with any speed improvement I get. The code can decide dynamically which algorithm to dispatch to.
Research
Unfortunately, the Wikipedia article on radix sort is useless. The section about an in-place variant is complete rubbish. The NIST-DADS section on radix sort is next to nonexistent. There's a promising-sounding paper called Efficient Adaptive In-Place Radix Sorting which describes the algorithm “MSL”. Unfortunately, this paper, too, is disappointing.
In particular, there are the following things.
First, the algorithm contains several mistakes and leaves a lot unexplained. In particular, it doesn’t detail the recursion call (I simply assume that it increments or reduces some pointer to calculate the current shift and mask values). Also, it uses the functions dest_group and dest_address without giving definitions. I fail to see how to implement these efficiently (that is, in O(1); at least dest_address isn’t trivial).
Last but not least, the algorithm achieves in-place-ness by swapping array indices with elements inside the input array. This obviously only works on numerical arrays. I need to use it on strings. Of course, I could just screw strong typing and go ahead assuming that the memory will tolerate my storing an index where it doesn’t belong. But this only works as long as I can squeeze my strings into 32 bits of memory (assuming 32 bit integers). That's only 16 characters (let's ignore for the moment that 16 > log(5,000,000)).
Another paper by one of the authors gives no accurate description at all, but it gives MSL’s runtime as sub-linear which is flat out wrong.
To recap: Is there any hope of finding a working reference implementation or at least a good pseudocode/description of a working in-place radix sort that works on DNA strings?
Well, here's a simple implementation of an MSD radix sort for DNA. It's written in D because that's the language that I use most and therefore am least likely to make silly mistakes in, but it could easily be translated to some other language. It's in-place but requires 2 * seq.length passes through the array.
void radixSort(string[] seqs, size_t base = 0) {
if(seqs.length == 0)
return;
size_t TPos = seqs.length, APos = 0;
size_t i = 0;
while(i < TPos) {
if(seqs[i][base] == 'A') {
swap(seqs[i], seqs[APos++]);
i++;
}
else if(seqs[i][base] == 'T') {
swap(seqs[i], seqs[--TPos]);
} else i++;
}
i = APos;
size_t CPos = APos;
while(i < TPos) {
if(seqs[i][base] == 'C') {
swap(seqs[i], seqs[CPos++]);
}
i++;
}
if(base < seqs[0].length - 1) {
radixSort(seqs[0..APos], base + 1);
radixSort(seqs[APos..CPos], base + 1);
radixSort(seqs[CPos..TPos], base + 1);
radixSort(seqs[TPos..seqs.length], base + 1);
}
}
Obviously, this is kind of specific to DNA, as opposed to being general, but it should be fast.
Edit:
I got curious whether this code actually works, so I tested/debugged it while waiting for my own bioinformatics code to run. The version above now is actually tested and works. For 10 million sequences of 5 bases each, it's about 3x faster than an optimized introsort.
I've never seen an in-place radix sort, and from the nature of the radix-sort I doubt that it is much faster than a out of place sort as long as the temporary array fits into memory.
Reason:
The sorting does a linear read on the input array, but all writes will be nearly random. From a certain N upwards this boils down to a cache miss per write. This cache miss is what slows down your algorithm. If it's in place or not will not change this effect.
I know that this will not answer your question directly, but if sorting is a bottleneck you may want to have a look at near sorting algorithms as a preprocessing step (the wiki-page on the soft-heap may get you started).
That could give a very nice cache locality boost. A text-book out-of-place radix sort will then perform better. The writes will still be nearly random but at least they will cluster around the same chunks of memory and as such increase the cache hit ratio.
I have no idea if it works out in practice though.
Btw: If you're dealing with DNA strings only: You can compress a char into two bits and pack your data quite a lot. This will cut down the memory requirement by factor four over a naiive representation. Addressing becomes more complex, but the ALU of your CPU has lots of time to spend during all the cache-misses anyway.
You can certainly drop the memory requirements by encoding the sequence in bits.
You are looking at permutations so, for length 2, with "ACGT" that's 16 states, or 4 bits.
For length 3, that's 64 states, which can be encoded in 6 bits. So it looks like 2 bits for each letter in the sequence, or about 32 bits for 16 characters like you said.
If there is a way to reduce the number of valid 'words', further compression may be possible.
So for sequences of length 3, one could create 64 buckets, maybe sized uint32, or uint64.
Initialize them to zero.
Iterate through your very very large list of 3 char sequences, and encode them as above.
Use this as a subscript, and increment that bucket.
Repeat this until all of your sequences have been processed.
Next, regenerate your list.
Iterate through the 64 buckets in order, for the count found in that bucket, generate that many instances of the sequence represented by that bucket.
when all of the buckets have been iterated, you have your sorted array.
A sequence of 4, adds 2 bits, so there would be 256 buckets.
A sequence of 5, adds 2 bits, so there would be 1024 buckets.
At some point the number of buckets will approach your limits.
If you read the sequences from a file, instead of keeping them in memory, more memory would be available for buckets.
I think this would be faster than doing the sort in situ as the buckets are likely to fit within your working set.
Here is a hack that shows the technique
#include <iostream>
#include <iomanip>
#include <math.h>
using namespace std;
const int width = 3;
const int bucketCount = exp(width * log(4)) + 1;
int *bucket = NULL;
const char charMap[4] = {'A', 'C', 'G', 'T'};
void setup
(
void
)
{
bucket = new int[bucketCount];
memset(bucket, '\0', bucketCount * sizeof(bucket[0]));
}
void teardown
(
void
)
{
delete[] bucket;
}
void show
(
int encoded
)
{
int z;
int y;
int j;
for (z = width - 1; z >= 0; z--)
{
int n = 1;
for (y = 0; y < z; y++)
n *= 4;
j = encoded % n;
encoded -= j;
encoded /= n;
cout << charMap[encoded];
encoded = j;
}
cout << endl;
}
int main(void)
{
// Sort this sequence
const char *testSequence = "CAGCCCAAAGGGTTTAGACTTGGTGCGCAGCAGTTAAGATTGTTT";
size_t testSequenceLength = strlen(testSequence);
setup();
// load the sequences into the buckets
size_t z;
for (z = 0; z < testSequenceLength; z += width)
{
int encoding = 0;
size_t y;
for (y = 0; y < width; y++)
{
encoding *= 4;
switch (*(testSequence + z + y))
{
case 'A' : encoding += 0; break;
case 'C' : encoding += 1; break;
case 'G' : encoding += 2; break;
case 'T' : encoding += 3; break;
default : abort();
};
}
bucket[encoding]++;
}
/* show the sorted sequences */
for (z = 0; z < bucketCount; z++)
{
while (bucket[z] > 0)
{
show(z);
bucket[z]--;
}
}
teardown();
return 0;
}
If your data set is so big, then I would think that a disk-based buffer approach would be best:
sort(List<string> elements, int prefix)
if (elements.Count < THRESHOLD)
return InMemoryRadixSort(elements, prefix)
else
return DiskBackedRadixSort(elements, prefix)
DiskBackedRadixSort(elements, prefix)
DiskBackedBuffer<string>[] buckets
foreach (element in elements)
buckets[element.MSB(prefix)].Add(element);
List<string> ret
foreach (bucket in buckets)
ret.Add(sort(bucket, prefix + 1))
return ret
I would also experiment grouping into a larger number of buckets, for instance, if your string was:
GATTACA
the first MSB call would return the bucket for GATT (256 total buckets), that way you make fewer branches of the disk based buffer. This may or may not improve performance, so experiment with it.
I'm going to go out on a limb and suggest you switch to a heap/heapsort implementation. This suggestion comes with some assumptions:
You control the reading of the data
You can do something meaningful with the sorted data as soon as you 'start' getting it sorted.
The beauty of the heap/heap-sort is that you can build the heap while you read the data, and you can start getting results the moment you have built the heap.
Let's step back. If you are so fortunate that you can read the data asynchronously (that is, you can post some kind of read request and be notified when some data is ready), and then you can build a chunk of the heap while you are waiting for the next chunk of data to come in - even from disk. Often, this approach can bury most of the cost of half of your sorting behind the time spent getting the data.
Once you have the data read, the first element is already available. Depending on where you are sending the data, this can be great. If you are sending it to another asynchronous reader, or some parallel 'event' model, or UI, you can send chunks and chunks as you go.
That said - if you have no control over how the data is read, and it is read synchronously, and you have no use for the sorted data until it is entirely written out - ignore all this. :(
See the Wikipedia articles:
Heapsort
Binary heap
"Radix sorting with no extra space" is a paper addressing your problem.
Performance-wise you might want to look at a more general string-comparison sorting algorithms.
Currently you wind up touching every element of every string, but you can do better!
In particular, a burst sort is a very good fit for this case. As a bonus, since burstsort is based on tries, it works ridiculously well for the small alphabet sizes used in DNA/RNA, since you don't need to build any sort of ternary search node, hash or other trie node compression scheme into the trie implementation. The tries may be useful for your suffix-array-like final goal as well.
A decent general purpose implementation of burstsort is available on source forge at http://sourceforge.net/projects/burstsort/ - but it is not in-place.
For comparison purposes, The C-burstsort implementation covered at http://www.cs.mu.oz.au/~rsinha/papers/SinhaRingZobel-2006.pdf benchmarks 4-5x faster than quicksort and radix sorts for some typical workloads.
You'll want to take a look at Large-scale Genome Sequence Processing by Drs. Kasahara and Morishita.
Strings comprised of the four nucleotide letters A, C, G, and T can be specially encoded into Integers for much faster processing. Radix sort is among many algorithms discussed in the book; you should be able to adapt the accepted answer to this question and see a big performance improvement.
You might try using a trie. Sorting the data is simply iterating through the dataset and inserting it; the structure is naturally sorted, and you can think of it as similar to a B-Tree (except instead of making comparisons, you always use pointer indirections).
Caching behavior will favor all of the internal nodes, so you probably won't improve upon that; but you can fiddle with the branching factor of your trie as well (ensure that every node fits into a single cache line, allocate trie nodes similar to a heap, as a contiguous array that represents a level-order traversal). Since tries are also digital structures (O(k) insert/find/delete for elements of length k), you should have competitive performance to a radix sort.
I would burstsort a packed-bit representation of the strings. Burstsort is claimed to have much better locality than radix sorts, keeping the extra space usage down with burst tries in place of classical tries. The original paper has measurements.
It looks like you've solved the problem, but for the record, it appears that one version of a workable in-place radix sort is the "American Flag Sort". It's described here: Engineering Radix Sort. The general idea is to do 2 passes on each character - first count how many of each you have, so you can subdivide the input array into bins. Then go through again, swapping each element into the correct bin. Now recursively sort each bin on the next character position.
Radix-Sort is not cache conscious and is not the fastest sort algorithm for large sets.
You can look at:
ti7qsort. ti7qsort is the fastest sort for integers (can be used for small-fixed size strings).
Inline QSORT
String sorting
You can also use compression and encode each letter of your DNA into 2 bits before storing into the sort array.
dsimcha's MSB radix sort looks nice, but Nils gets closer to the heart of the problem with the observation that cache locality is what's killing you at large problem sizes.
I suggest a very simple approach:
Empirically estimate the largest size m for which a radix sort is efficient.
Read blocks of m elements at a time, radix sort them, and write them out (to a memory buffer if you have enough memory, but otherwise to file), until you exhaust your input.
Mergesort the resulting sorted blocks.
Mergesort is the most cache-friendly sorting algorithm I'm aware of: "Read the next item from either array A or B, then write an item to the output buffer." It runs efficiently on tape drives. It does require 2n space to sort n items, but my bet is that the much-improved cache locality you'll see will make that unimportant -- and if you were using a non-in-place radix sort, you needed that extra space anyway.
Please note finally that mergesort can be implemented without recursion, and in fact doing it this way makes clear the true linear memory access pattern.
First, think about the coding of your problem. Get rid of the strings, replace them by a binary representation. Use the first byte to indicate length+encoding. Alternatively, use a fixed length representation at a four-byte boundary. Then the radix sort becomes much easier. For a radix sort, the most important thing is to not have exception handling at the hot spot of the inner loop.
OK, I thought a bit more about the 4-nary problem. You want a solution like a Judy tree for this. The next solution can handle variable length strings; for fixed length just remove the length bits, that actually makes it easier.
Allocate blocks of 16 pointers. The least significant bit of the pointers can be reused, as your blocks will always be aligned. You might want a special storage allocator for it (breaking up large storage into smaller blocks). There are a number of different kinds of blocks:
Encoding with 7 length bits of variable-length strings. As they fill up, you replace them by:
Position encodes the next two characters, you have 16 pointers to the next blocks, ending with:
Bitmap encoding of the last three characters of a string.
For each kind of block, you need to store different information in the LSBs. As you have variable length strings you need to store end-of-string too, and the last kind of block can only be used for the longest strings. The 7 length bits should be replaced by less as you get deeper into the structure.
This provides you with a reasonably fast and very memory efficient storage of sorted strings. It will behave somewhat like a trie. To get this working, make sure to build enough unit tests. You want coverage of all block transitions. You want to start with only the second kind of block.
For even more performance, you might want to add different block types and a larger size of block. If the blocks are always the same size and large enough, you can use even fewer bits for the pointers. With a block size of 16 pointers, you already have a byte free in a 32-bit address space. Take a look at the Judy tree documentation for interesting block types. Basically, you add code and engineering time for a space (and runtime) trade-off
You probably want to start with a 256 wide direct radix for the first four characters. That provides a decent space/time tradeoff. In this implementation, you get much less memory overhead than with a simple trie; it is approximately three times smaller (I haven't measured). O(n) is no problem if the constant is low enough, as you noticed when comparing with the O(n log n) quicksort.
Are you interested in handling doubles? With short sequences, there are going to be. Adapting the blocks to handle counts is tricky, but it can be very space-efficient.
While the accepted answer perfectly answers the description of the problem, I've reached this place looking in vain for an algorithm to partition inline an array into N parts. I've written one myself, so here it is.
Warning: this is not a stable partitioning algorithm, so for multilevel partitioning, one must repartition each resulting partition instead of the whole array. The advantage is that it is inline.
The way it helps with the question posed is that you can repeatedly partition inline based on a letter of the string, then sort the partitions when they are small enough with the algorithm of your choice.
function partitionInPlace(input, partitionFunction, numPartitions, startIndex=0, endIndex=-1) {
if (endIndex===-1) endIndex=input.length;
const starts = Array.from({ length: numPartitions + 1 }, () => 0);
for (let i = startIndex; i < endIndex; i++) {
const val = input[i];
const partByte = partitionFunction(val);
starts[partByte]++;
}
let prev = startIndex;
for (let i = 0; i < numPartitions; i++) {
const p = prev;
prev += starts[i];
starts[i] = p;
}
const indexes = [...starts];
starts[numPartitions] = prev;
let bucket = 0;
while (bucket < numPartitions) {
const start = starts[bucket];
const end = starts[bucket + 1];
if (end - start < 1) {
bucket++;
continue;
}
let index = indexes[bucket];
if (index === end) {
bucket++;
continue;
}
let val = input[index];
let destBucket = partitionFunction(val);
if (destBucket === bucket) {
indexes[bucket] = index + 1;
continue;
}
let dest;
do {
dest = indexes[destBucket] - 1;
let destVal;
let destValBucket = destBucket;
while (destValBucket === destBucket) {
dest++;
destVal = input[dest];
destValBucket = partitionFunction(destVal);
}
input[dest] = val;
indexes[destBucket] = dest + 1;
val = destVal;
destBucket = destValBucket;
} while (dest !== index)
}
return starts;
}