I'd be very grateful for your help with something probably quite simple.
I have a table (table2.txt), which has a single column of randomly generated numbers, and is about a million lines long.
2655087
3721239
5728533
9082076
2016819
8983893
9446748
6607974
I want to create a loop that repeats 10,000 times, so that for iteration 1, I print lines 1 to 4 to a file (file0.txt), for iteration 2, I print lines 5 to 8 (file1.txt), and so on.
What I have so far is this:
#!/bin/bash
for i in {0..10000}
do
awk 'NR==((4 * "$i") +1)' table2.txt > file"$i".txt
awk 'NR==((4 * "$i") +2)' table2.txt >> file"$i".txt
awk 'NR==((4 * "$i") +3)' table2.txt >> file"$i".txt
awk 'NR==((4 * "$i") +4)' table2.txt >> file"$i".txt
done
Desired output for file0.txt:
2655087
3721239
5728533
9082076
Desired output for file1.txt:
2016819
8983893
9446748
6607974
Something is going wrong with this, because I am getting identical outputs from all my files (i.e. they all look like the desired output of file0.txt). Hopefully you can see from my script that during the second iteration, i.e. when i=2, I want the output to be the values of rows 5, 6, 7 and 8.
This is probably a very simple syntax error, and I would be grateful if you can tell me where I'm going wrong (or give me a less cumbersome solution!)
Thank you very much.
The beauty of awk is that you can do this in one awk line :
awk '{ print > ("file"c".txt") }
(NR % 4 == 0) { ++c }
(c == 10001) { exit }' <file>
This can be slightly more optimized and file handling friendly (cfr. James Brown):
awk 'BEGIN{f="file0.txt" }
{ print > f }
(NR % 4 == 0) { close(f); f="file"++c".txt" }
(c == 10001) { exit }' <file>
Why did your script fail?
The reason why your script is failing is because you used single quotes and tried to pass a shell variable to it. Your lines should read :
awk 'NR==((4 * '$i') +1)' table2.txt > file"$i".txt
but this is very ugly and should be improved with
awk -v i=$i 'NR==(4*i+1)' table2.txt > file"$i".txt
Why is your script slow?
The way you are processing your file is by doing a loop of 10001 iterations. Per iterations, you perform 4 awk calls. Each awk call reads the full file completely and writes out a single line. So in the end you read your files 40004 times.
To optimise your script step by step, I would do the following :
Terminate awk to step reading the file after the line is print
#!/bin/bash
for i in {0..10000}; do
awk -v i=$i 'NR==(4*i+1){print; exit}' table2.txt > file"$i".txt
awk -v i=$i 'NR==(4*i+2){print; exit}' table2.txt >> file"$i".txt
awk -v i=$i 'NR==(4*i+3){print; exit}' table2.txt >> file"$i".txt
awk -v i=$i 'NR==(4*i+4){print; exit}' table2.txt >> file"$i".txt
done
Merge the 4 awk calls into a single one. This prevents reading the first lines over and over per loop cycle.
#!/bin/bash
for i in {0..10000}; do
awk -v i=$i '(NR<=4*i) {next} # skip line
(NR> 4*(i+1)}{exit} # exit awk
1' table2.txt > file"$i".txt # print line
done
remove the final loop (see top of this answer)
This is functionally the same as #JamesBrown's answer but just written more awk-ishly so don't accept this, I just posted it to show the more idiomatic awk syntax as you can't put formatted code in a comment.
awk '
(NR%4)==1 { close(out); out="file" c++ ".txt" }
c > 10000 { exit }
{ print > out }
' file
See why-is-using-a-shell-loop-to-process-text-considered-bad-practice for some of the reasons why you should avoid shell loops for manipulating text.
With just bash you can do it very simple:
chunk=4
files=10000
head -n $(($chunk*$files)) table2.txt |
split -d -a 5 --additional-suffix=.txt -l $chunk - file
Basically read first 10k lines and split them into chunks of 4 consecutive lines, using file as prefix and .txt as suffix for the new files.
If you want a numeric identifier, you will need 5 digits (-a 5), as pointed in the comments (credit: #kvantour).
Another awk:
$ awk '{if(NR%4==1){if(i==10000)exit;close(f);f="file" i++ ".txt"}print > f}' file
$ ls
file file0.txt file1.txt
Explained:
awk ' {
if(NR%4==1) { # use mod to recognize first record of group
if(i==10000) # exit after 10000 files
exit # test with 1
close(f) # close previous file
f="file" i++ ".txt" # make a new filename
}
print > f # output record to file
}' file
Related
I've got this big txt file with ID names. It has 2500 lines, one column. Let's call it file.txt
H3430
H3467
H9805
Also, I've got another file, index.txt, which has 390 numbers:
1
4
9
13
15
Those numbers are the number of lines (of IDs) I have to extract from file.txt. I need to generate another file, newfile.txt let's call it, with only the 390 IDs that are in the specific lines that index.txt demands (the first ID of the list, the fourth, the ninth, and so on).
So, I tried to do the following loop, but it didn't work.
num=$'index.txt'
for i in num
do
awk 'NR==i' "file.txt" > newfile.txt
done
I'm a noob regarding this matters... so, I need some help. Even if it is with my loop or with a new solution suggested by you. Thank you :)
Lets create an example file that simulates your 2500 line file with seq:
$ seq 2500 > /tmp/2500
And use the example you have for the line numbers to print in a file called 390:
$ echo "1
4
9
13
15" > /tmp/390
You can print line N in the file 2500 by reading the line numbers into an array and printing the lines if in that array:
$ awk 'NR==FNR{ a[$1]++; next} a[FNR]' /tmp/390 /tmp/2500
You can also use a sed command file:
$ sed 's/$/p/' /tmp/390 > /tmp/sed_cmd
$ sed -n -f /tmp/sed_cmd /tmp/2500
With GNU sed, you can do sed 's/$/p/' /tmp/390 | sed -n -f - /tmp/2500 but that does not work on OS X :-(
You can do this tho:
$ sed -n -f <(sed 's/$/p/' /tmp/390) /tmp/2500
You can read the index.txt file in to a map and then compare it with the line number of file.txt. Redirect the output to another file.
awk 'NR==FNR{line[$1]; next}(FNR in line){print $1}' index.txt file.txt > newfile.txt
When you work with two files, using FNR is necessary as it gets reset to 1 when new file starts (on the contrary NR will continue to increment).
As Ed Morton suggests in the comments. The command could then be refined to further remove {print $1} since awk prints by default on truth.
awk 'NR==FNR{line[$1]; next} FNR in line' index.txt file.txt > newfile.txt
If index.txt is sorted, we could walk file.txt in order.
That reduces the number of actions to the very minimum (faster script):
awk 'BEGIN
{ indexfile="index.txt"
if ( (getline ind < indexfile) <= 0)
{ printf("Empty %s\n; exiting",indexfile);exit }
}
{ if ( FNR < ind ) next
if ( FNR == ind ) printf("%s %s\n",ind,$0)
if ( (getline ind < indexfile) <= 0) {exit}
}' file.txt
If the file is not actually sorted, get it quickly sorted with sort:
sort -n index.txt > temp.index.txt
rm index.txt
mv temp.index.txt index.txt
I have two columns in a file, and I want to automate summing both values per row
for example
read write
5 6
read write
10 2
read write
23 44
I want to then sum the "read" and "write" of each row. Eventually after summing, I'm finding the max sum and putting that max value in a file. I feel like I have to use grep -v to rid of the column headers per row, which like stated in the answers, makes the code inefficient since I'm grepping the entire file just to read a line.
I currently have this in a bash script (within a for loop where $x is the file name) to sum the columns line by line
lines=`grep -v READ $x|wc -l | awk '{print $1}'`
line_num=1
arr_num=0
while [ $line_num -le $lines ]
do
arr[$arr_num]=`grep -v READ $x | sed $line_num'q;d' | awk '{print $2 + $3}'`
echo $line_num
line_num=$[$line_num+1]
arr_num=$[$arr_num+1]
done
However, the file to be summed has 270,000+ rows. The script has been running for a few hours now, and it is nowhere near finished. Is there a more efficient way to write this so that it does not take so long?
Use awk instead and take advantage of modulus function:
awk '!(NR%2){print $1+$2}' infile
awk is probably faster, but the idiomatic bash way to do this is something like:
while read -a line; do # read each line one-by-one, into an array
# use arithmetic expansion to add col 1 and 2
echo "$(( ${line[0]} + ${line[1]} ))"
done < <(grep -v READ input.txt)
Note the file input file is only read once (by grep) and the number of externally forked programs is kept to a minimum (just grep, called only once for the whole input file). The rest of the commands are bash builtins.
Using the <( ) process substition, in case variables set in the while loop are required out of scope of the while loop. Otherwise a | pipe could be used.
Your question is pretty verbose, yet your goal is not clear. The way I read it, your numbers are on every second line, and you want only to find the maximum sum. Given that:
awk '
NR%2 == 1 {next}
NR == 2 {max = $1+$2; next}
$1+$2 > max {max = $1+$2}
END {print max}
' filename
You could also use a pipeline with tools that implicitly loop over the input like so:
grep -v read INFILE | tr -s ' ' + | bc | sort -rn | head -1 > OUTFILE
This assumes there are spaces between your read and write data values.
Why not run:
awk 'NR==1 { print "sum"; next } { print $1 + $2 }'
You can afford to run it on the file while the other script it still running. It'll be complete in a few seconds at most (prediction). When you're confident it's right, you can kill the other process.
You can use Perl or Python instead of awk if you prefer.
Your code is running grep, sed and awk on each line of the input file; that's damnably expensive. And it isn't even writing the data to a file; it is creating an array in Bash's memory that'll need to be printed to the output file later.
Assuming that it's always one 'header' row followed by one 'data' row:
awk '
BEGIN{ max = 0 }
{
if( NR%2 == 0 ){
sum = $1 + $2;
if( sum > max ) { max = sum }
}
}
END{ print max }' input.txt
Or simply trim out all lines that do not conform to what you want:
grep '^[0-9]\+\s\+[0-9]\+$' input.txt | awk '
BEGIN{ max = 0 }
{
sum = $1 + $2;
if( sum > max ) { max = sum }
}
END{ print max }' input.txt
I have a file and I want to extract specific lines from that file like lines 2, 10, 15,21, .... and so on. There are around 200 thousand lines to be extracted from the file. How can I do it efficiently in bash
Maybe looking for:
sed -n -e 1p -e 4p afile
Put the linenumbers of the lines you want in a file called "wanted", like this:
2
10
15
21
Then run this script:
#!/bin/bash
while read w
do
sed -n ${w}p yourfile
done < wanted
TOTALLY ALTERNATIVE METHOD
Or you could let "awk" do it all for you, like this which is probably miles faster since you won't have to create 200,000 sed processes:
awk 'FNR==NR{a[$1]=1;next}{if(FNR in a){print;}}' wanted yourfile
The FNR==NR portion detects when awk is reading the file called "wanted" and if so, it sets element "$1" of array "a" to "1" so we know that this line number is wanted. The stuff in the second set of curly braces is active when processing your bigger file only and it prints the current line if its linenumber is in the array "a" we created when reading the "wanted" file.
$ gawk 'ARGIND==1 { L[$0]++ }; ARGIND==2 && FNR in L' lines file > file.lines
Wanted line numbers have to be stored in lines delimited by newline and they may safely be in random order. It almost exactly the same as #Mark Setchell’s second method, but uses a little more clear way to determine which file is current. Although this ARGIND is GNU extension, so gawk. If you are limited to original AWK or mawk, you can write it as:
$ awk 'FILENAME==ARGV[1] { L[$0]++ }; FILENAME==ARGV[2] && FNR in L' lines file > file.lines
Efficiency test:
$ awk 'BEGIN { for (i=1; i<=1000000; i++) print i }' > file
$ shuf -i 1-1000000 -n 200000 > lines
$ time gawk 'ARGIND==1 { L[$0]++ }; ARGIND==2 && FNR in L' lines file > file.lines
real 0m1.734s
user 0m1.460s
sys 0m0.052s
UPD:
As #Costi Ciudatu pointed out, there is room for impovement for the case when all wanted lines are in the head of a file.
#!/usr/bin/gawk -f
ARGIND==1 { L[$0]++ }
ENDFILE { L_COUNT = FNR }
ARGIND==2 && FNR in L { L_PRINTED++; print }
ARGIND==2 && L_PRINTED == L_COUNT { exit 0 }
Sript interrupts when last line is printed, so now it take few milliseconds to filter out 2000 random lines from first 1 % of a one million lines file.
$ time ./getlines.awk lines file > file.lines
real 0m0.016s
user 0m0.012s
sys 0m0.000s
While reading a whole file still takes about a second.
$ time gawk 'ARGIND==1 { L[$0]++ }; ARGIND==2 && FNR in L' lines file > file.lines
real 0m0.780s
user 0m0.756s
sys 0m0.016s
Provided your system supports sed -f - (i.e. for sed to read its script on standard input; it works on Linux, but not on some other platforms) you can turn the file of line numbers into a sed script, naturally using sed:
sed 's/$/p/' lines | sed -n -f - inputfile >output
If the lines you're interested in are close to the beginning of the file, you can make use of head and tail to efficiently extract specific lines.
For your example line numbers (assuming that list doesn't go on until close to 200,000), a dummy but still efficient approach to read those lines would be the following:
for n in 2 10 15 21; do
head -n $n /your/large/file | tail -1
done
sed Example
sed -n '2p' file
awk Example
awk 'NR==2' file
this will print 2nd line of file
use same logic in loop & try.
say a for loop
for VARIABLE in 2 10 15 21
do
awk "NR==$VARIABLE" file
done
Give your line numbers this way..
I am a biologist that is starting to have to learn some elementary scripting skills to deal with large DNA sequence data sets. So please go easy on me. I am doing this all in bash. I have a file with my data formatted like this:
CLocus_58919_Sample_25_Locus_33235_Allele_0
TGCAGGTGCTTCCAGTTGTCTTTGTAGCGTCCCACCATGATCTGCAGGTCCTTG
CLocus_58919_Sample_9_Locus_54109_Allele_0
TGCAGGTGCTTCCAGTTGTCTTTGTAGCGTCCCACCATGATCTGCAGGTCCTTG
What I need is to do is loop through this file and write all the sequences from the same sample into their own file. Just to be clear, these sequences come from samples 25 and 9. So my idea was to use awk to reformat my file in the following way:
CLocus_58919_Sample_25_Locus_33235_Allele_0_TGCAGGTGCTTCCAGTTGTCTTTGTAGCGTCCCACCATGATCTGCAGGTCCTTG
CLocus_58919_Sample_9_Locus_54109_Allele_0_TGCAGGTGCTTCCAGTTGTCTTTGTAGCGTCCCACCATGATCTGCAGGTCCTTG
then pipe this into another awk if statement to say "if sample=$i then write out that entire line to a file named sample.$i" Here is my code so far:
#!/bin/bash
a=`ls /scratch/tkchafin/data/raw | wc -l`;
b=1;
c=$((a-b));
mkdir /scratch/tkchafin/data/phylogenetics
for ((i=0; i<=$((c)); i++)); do
awk 'ORS=NR%2?"_":"\n"' $1 | awk -F_ '{if($4==$i) print}' >> /scratch/tkchafin/data/phylogenetics/sample.$i
done;
I understand this is not working because $i is in single quotes so bash is not recognizing it. I know awk has a -v option for passing external variables to it, but I don't know how I would apply that in this case. I tried to move the for loop inside the awk statement but this does not produce the desired result either. Any help would be much appreciated.
You can have awk write directly to the desired output file, without a shell loop:
awk -F_ '(NR % 2) == 1 { line1 = $0; fn="/scratch/tkchafin/data/phylogenetics/sample."$4; }
(NR % 2) == 0 { print line1"_"$0 > fn; }' "$1"
But to show how you would use -v in your version, it would be:
for ((i=0; i<=$((c)); i++)); do
awk 'ORS=NR%2?"_":"\n"' $1 | awk -F_ -v i=$i '$4 == i' >> /scratch/tkchafin/data/phylogenetics/sample.$i
done;
It's difficult to tell what is being asked here. This question is ambiguous, vague, incomplete, overly broad, or rhetorical and cannot be reasonably answered in its current form. For help clarifying this question so that it can be reopened, visit the help center.
Closed 9 years ago.
I have a sample file which has thousands of lines.
I want to print text between two line numbers in that file. I don't want to input line numbers manually, rather I have a file which contains list of line numbers between which text has to be printed.
Example : linenumbers.txt
345|789
999|1056
1522|1366
3523|3562
I need a shell script which will read line numbers from this file and print the text between each range of lines into a separate (new) file.
That is, it should print lines between 345 and 789 into a new file, say File1.txt, and print text between lines 999 and 1056 into a new file, say File2.txt, and so on.
considering your target file has only thousands of lines. here is a quick and dirty solution.
awk -F'|' '{system("sed -n \""$1","$2"p\" targetFile > file"NR)}' linenumbers.txt
the targetFile is your file containing thousands of lines.
the oneliner does not require your linenumbers.txt to be sorted.
the oneliner allows line range to be overlapped in your linenumbers.txt
after running the command above, you will have n filex files. n is the row counts of linenumbers.txt x is from 1-n you can change the filename pattern as you want.
Here's one way using GNU awk. Run like:
awk -f script.awk numbers.txt file.txt
Contents of script.awk:
BEGIN {
# set the field separator
FS="|"
}
# for the first file in the arguments list
FNR==NR {
# add the row number and field one as keys to a multidimensional array with
# a value of field two
a[NR][$1]=$2
# skip processing the rest of the code
next
}
# for the second file in the arguments list
{
# for every element in the array's first dimension
for (i in a) {
# for every element in the second dimension
for (j in a[i]) {
# ensure that the first field is treated numerically
j+=0
# if the line number is greater than the first field
# and smaller than the second field
if (FNR>=j && FNR<=a[i][j]) {
# print the line to a file with the suffix of the first file's
# line number (the first dimension)
print > "File" i
}
}
}
}
Alternatively, here's the one-liner:
awk -F "|" 'FNR==NR { a[NR][$1]=$2; next } { for (i in a) for (j in a[i]) { j+=0; if (FNR>=j && FNR<=a[i][j]) print > "File" i } }' numbers.txt file.txt
If you have an 'old' awk, here's the version with compatibility. Run like:
awk -f script.awk numbers.txt file.txt
Contents of script.awk:
BEGIN {
# set the field separator
FS="|"
}
# for the first file in the arguments list
FNR==NR {
# add the row number and field one as a key to a pseudo-multidimensional
# array with a value of field two
a[NR,$1]=$2
# skip processing the rest of the code
next
}
# for the second file in the arguments list
{
# for every element in the array
for (i in a) {
# split the element in to another array
# b[1] is the row number and b[2] is the first field
split(i,b,SUBSEP)
# if the line number is greater than the first field
# and smaller than the second field
if (FNR>=b[2] && FNR<=a[i]) {
# print the line to a file with the suffix of the first file's
# line number (the first pseudo-dimension)
print > "File" b[1]
}
}
}
Alternatively, here's the one-liner:
awk -F "|" 'FNR==NR { a[NR,$1]=$2; next } { for (i in a) { split(i,b,SUBSEP); if (FNR>=b[2] && FNR<=a[i]) print > "File" b[1] } }' numbers.txt file.txt
I would use sed to process the sample data file because it is simple and swift. This requires a mechanism for converting the line numbers file into the appropriate sed script. There are many ways to do this.
One way uses sed to convert the set of line numbers into a sed script. If everything was going to standard output, this would be trivial. With the output needing to go to different files, we need a line number for each line in the line numbers file. One way to give line numbers is the nl command. Another possibility would be to use pr -n -l1. The same sed command line works with both:
nl linenumbers.txt |
sed 's/ *\([0-9]*\)[^0-9]*\([0-9]*\)|\([0-9]*\)/\2,\3w file\1.txt/'
For the given data file, that generates:
345,789w > file1.txt
999,1056w > file2.txt
1522,1366w > file3.txt
3523,3562w > file4.txt
Another option would be to have awk generate the sed script:
awk -F'|' '{ printf "%d,%dw > file%d.txt\n", $1, $2, NR }' linenumbers.txt
If your version of sed will allow you to read its script from standard input with -f - (GNU sed does; BSD sed does not), then you can convert the line numbers file into a sed script on the fly, and use that to parse the sample data:
awk -F'|' '{ printf "%d,%dw > file%d.txt\n", $1, $2, NR }' linenumbers.txt |
sed -n -f - sample.data
If your system supports /dev/stdin, you can use one of:
awk -F'|' '{ printf "%d,%dw > file%d.txt\n", $1, $2, NR }' linenumbers.txt |
sed -n -f /dev/stdin sample.data
awk -F'|' '{ printf "%d,%dw > file%d.txt\n", $1, $2, NR }' linenumbers.txt |
sed -n -f /dev/fd/0 sample.data
Failing that, use an explicit script file:
awk -F'|' '{ printf "%d,%dw > file%d.txt\n", $1, $2, NR }' linenumbers.txt > sed.script
sed -n -f sed.script sample.data
rm -f sed.script
Strictly, you should deal with ensuring the temporary file name is unique (mktemp) and removed even if the script is interrupted (trap):
tmp=$(mktemp sed.script.XXXXXX)
trap "rm -f $tmp; exit 1" 0 1 2 3 13 15
awk -F'|' '{ printf "%d,%dw > file%d.txt\n", $1, $2, NR }' linenumbers.txt > $tmp
sed -n -f $tmp sample.data
rm -f $tmp
trap 0
The final trap 0 allows your script to exit successfully; omit it, and you script will always exit with status 1.
I've ignored Perl and Python; either could be used for this in a single command. The file management is just fiddly enough that using sed seems simpler. You could also use just awk, either with a first awk script writing an awk script to do the heavy duty work (trivial extension of the above), or having a single awk process read both files and produce the required output (harder, but far from impossible).
If nothing else, this shows that there are many possible ways of doing the job. If this is a one-off exercise, it really doesn't matter very much which you choose. If you will be doing this repeatedly, then choose the mechanism that you like. If you're worried about performance, measure. It is likely that converting the line numbers into a command script is a negligible cost; processing the sample data with the command script is where the time is taken. I would expect sed to excel at that point; I've not measured to confirm that it does.
You could do the following
# myscript.sh
linenumbers="linenumber.txt"
somefile="afile"
while IFS=\| read start end ; do
echo "sed -n '$start,${end}p;${end}q;' $somefile > $somefile-$start-$end"
done < $linenumbers
run it like so sh myscript.sh
sed -n '345,789p;789q;' afile > afile-345-789
sed -n '999,1056p;1056q;' afile > afile-999-1056
sed -n '1522,1366p;1366q;' afile > afile-1522-1366
sed -n '3523,3562p;3562q;' afile > afile-3523-3562
then when you're happy do sh myscript.sh | sh
EDIT Added William's excellent points on style and correctness.
EDIT Explanation
The basic idea is to get a script to generate a series of shell commands that can be checked for correctness first before being executed by "| sh".
sed -n '345,789p;789q; means use sed and don't echo each line (-n) ; there are two commands saying from line 345 to 789 p(rint) the lines and the second command is at line 789 q(uit) - by quitting on the last line you save having sed read all the input file.
The while loop reads from the $linenumbers file using read, read if given more than one variable name populates each with a field from the input, a field is usually separated by space and if there are too few variable names then read will put the remaining data into the last variable name.
You can put the following in at your shell prompt to understand that behaviour.
ls -l | while read first rest ; do
echo $first XXXX $rest
done
Try adding another variable second to the above to see what happens then, it should be obvious.
The problem is your data is delimited by |s and that's where using William's suggestion of IFS=\| works as now when reading from the input the IFS has changed and the input is now separated by |s and we get the desired result.
Others can feel free to edit,correct and expand.
To extract the first field from 345|789 you can e.g use awk
awk -F'|' '{print $1}'
Combine that with the answers received from your other question and you will have a solution.
This might work for you (GNU sed):
sed -r 's/(.*)\|(.*)/\1,\2w file-\1-\2.txt/' | sed -nf - file