This question already has answers here:
Print lines in one file matching patterns in another file
(5 answers)
Closed 2 years ago.
How I can filter a file (list2.txt) using another list (list1.txt)?
For example
list1.txt:
AAA
002
list2.txt:
treu____ DDD
tryu____ EEE
657r____ 002
25oi____ AAA
ytry____ TRE
tr35____ AAA
kgir____ IUY
output.txt:
657r____ 002
25oi____ AAA
tr35____ AAA
Could you help me please?
Have a look at the man-page for grep. Perhaps something like
grep -wF -f list1.txt list2.txt
will do the job. Whether or not -w is appropriate in your case, is something only you can decide.
Based on your shown samples, could you please try following. Written and tested in GNU awk.
awk 'FNR==NR{arr[$1];next} ($2 in arr)' list1.txt list2.txt
Explanation: Adding detailed explanation for above.
awk ' ##Starting awk program from here.
FNR==NR{ ##Checking condition which will be TRUE when list1.txt is being read.
arr[$1] ##Creating arr with index as 1st field on current line.
next ##next will skip all further statements from here.
}
($2 in arr) ##Checking condition if 2nd field is present in arr then print that line from list2.txt
' list1.txt list2.txt ##Mentioning Input_file names here.
Using awk
awk -F "\t" 'NR==FNR { map[$1]=1;next } map[$2]==1 { print }' list1.txt list2.txt
Process the first file (NR==FNR) and set up an array called map with the first tab separated field as the index and skip to the next line. Then for the second file, check if there is an entry for the second tab delimited field in the array and if there is, print the line
Related
I have a big file with thousand lines that looks like:
>ENST00001234.1
ACGTACGTACGG
TTACCCAGTACG
ATCGCATTCAGC
>ENST00002235.4
TTACGCAT
TAGGCCAG
>ENST00005546.9
TTTATCGC
TTAGGGTAT
I want to grep specific ids (after > sign), for example, ENST00001234.1 then want to get lines after the match until the next > [regardless of the number of lines]. I want to grep about 63 ids in this way at once.
If I grep ENST00001234.1 and ENST00005546.9 ids, the ideal output should be:
>ENST00001234.1
ACGTACGTACGG
TTACCCAGTACG
ATCGCATTCAGC
>ENST00005546.9
TTTATCGC
TTAGGGTAT
I tried awk '/ENST00001234.1/ENST00005546.9/{print}' but it did not help.
You can set > as the record separator:
$ awk -F'\n' -v RS='>' -v ORS= '$1=="ENST00001234.1"{print RS $0}' ip.txt
>ENST00001234.1
ACGTACGTACGG
TTACCCAGTACG
ATCGCATTCAGC
-F'\n' to make it easier to compare the search term with first line
-v RS='>' set > as input record separator
-v ORS= clear the output record separator, otherwise you'll get extra newline in the output
$1=="ENST00001234.1" this will do string comparison and matches the entire first line, otherwise you'll have to escape regex metacharacters like . and add anchors
print RS $0 if match is found, print > and the record content
If you want to match more than one search terms, put them in a file:
$ cat f1
ENST00001234.1
ENST00005546.9
$ awk 'BEGIN{FS="\n"; ORS=""}
NR==FNR{a[$0]; next}
$1 in a{print RS $0}' f1 RS='>' ip.txt
>ENST00001234.1
ACGTACGTACGG
TTACCCAGTACG
ATCGCATTCAGC
>ENST00005546.9
TTTATCGC
TTAGGGTAT
Here, the contents of f1 is used to build the keys for array a. Once the first file is read, RS='>' will change the record separator for the second file.
$1 in a will check if the first line matches a key in array a
EDIT(Generic solution): In case one has to look for multiple strings in Input_file then mention all of them in awk variable search with ,(comma) separated and that should print all matched ones(respective lines).
awk -v search="ENST00001234.1,ENST00002235.4" '
BEGIN{
num=split(search,arr,",")
for(i=1;i<=num;i++){
look[">"arr[i]]
}
}
/^>/{
if($0 in look){ found=1 }
else { found="" }
}
found
' Input_file
In case you want to read ids(which needs to be searched into Input_file) from another file then try following. Where look_file is the file which has all ids needs to be searched and Input_file is the actual content file.
awk '
FNR==NR{
look[">"$0]
}
/^>/{
if($0 in look){ found=1 }
else { found="" }
}
found
' look_file Input_file
For single text search: Could you please try following. Written and tested with shown samples in GNU awk. One could give string which needs to be searched in variable search as per their requirement.
awk -v search="ENST00001234.1" '
/^>/{
if($0==">"search){ found=1 }
else { found="" }
}
found
' Input_file
Explanation: Adding detailed explanation for above.
awk -v search="ENST00001234.1" ' ##Starting awk program from here and setting and setting search variable value what we need to look.
/^>/{ ##Checking condition if a line starts from > then do following.
if($0==">"search){ found=1 } ##Checking condition if current line equals to > search(variable value) then set found to 1 here.
else { found="" } ##else set found to NULL here.
}
found ##Checking condition if found is SET then print that line.
' Input_file ##Mentioning Input_file name here.
There is no need to reinvent the wheel. There are several bioinformatics tools for this task (extract fasta sequences using a list of sequence ids). For example, seqtk subseq:
Extract sequences with names in file name.lst, one sequence name per line:
seqtk subseq in.fq name.lst > out.fq
It works with fasta files as well.
Use conda install seqtk or conda create --name seqtk seqtk to install the seqtk package, which has other useful functionalities, and is very fast.
SEE ALSO:
Retrieve FASTA sequences using sequence ids
Extract fasta sequences from a file using a list in another file
How To Extract A Sequence From A Big (6Gb) Multifasta File?
extract sequences from multifasta file by ID in file using awk
I want to change the sequence names in a fasta file according a text file containing new names. I found several approaches but seqkit made a good impression, anyway I can´t get it running. Replace key with value by key-value file
The fasta file seq.fa looks like
>BC1
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC
>BC2
TGCATGCATGCATGCATGCATGCATGCATGCATGCATGCG
GCATGCATGCATGCATGCATGCATGCATGCATGCG
>BC3
GCATGCATGCATGCATGCATGCATGCATGCATGCCCCCCC
TGCATGCATGCATG
and the ref.txt tab delimited text file like
BC1 1234
BC2 1235
BC3 1236
using siqkit in Git Bash runs trough the file but doesn´t change the names.
seqkit replace -p' (.+)$' -r' {kv}' -k ref.txt seq.fa --keep-key
I´m used to r and new to bash and can´t find the bug but guess I need to adjust for tab and _ ?
As in the example https://bioinf.shenwei.me/seqkit/usage/#replace part 7. Replace key with value by key-value file the sequence name is tab delimited and only the second part is replaced.
Advise how to adjust the code?
Desired outcome should look like: Replacing BC1 by the number in the text file 1234
>1234
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC
>1235
TGCATGCATGCATGCATGCATGCATGCATGCATGCATGCG
GCATGCATGCATGCATGCATGCATGCATGCATGCG
>1236
GCATGCATGCATGCATGCATGCATGCATGCATGCCCCCCC
TGCATGCATGCATG
could you please try following.
awk '
FNR==NR{
a[$1]=$2
next
}
($2 in a) && /^>/{
print ">"a[$2]
next
}
1
' ref.txt FS="[> ]" seq.fa
Explanation: Adding detailed explanation for above code.
awk ' ##Starting awk program here.
FNR==NR{ ##FNR==NR is condition which will be TRUE when 1st Input_file named ref.txt will be read.
a[$1]=$2 ##Creating an array named a whose index is $1 and value is $2 of current line.
next ##next will skip all further statements from here.
} ##Closing BLOCK for FNR==NR condition here.
($2 in a) && /^>/{ ##Checking condition if $2 of current line is present in array a and starts with > then do following.
print ">"a[$2] ##Printing > and value of array a whose index is $2.
next ##next will skip all further statements from here.
}
1 ##Mentioning 1 will print the lines(those which are NOT starting with > in Input_file seq.fa)
' ref.txt FS="[> ]" seq.fa ##Mentioning Input_file names here and setting FS= either space or > for Input_file seq.fa here.
EDIT: As per OP's comment need to add >1234_1 occurrence number too in output so adding following code now.
awk '
FNR==NR{
a[$1]=$2
b[$1]=++c[$2]
next
}
($2 in a) && /^>/{
print ">"a[$2]"_"b[$2]
next
}
1
' ref.txt FS="[> ]" seq.fa
awk solution that doesn't require GNU awk:
awk 'NR==FNR{a[$1]=$2;next}
NF==2{$2=a[$2]; print ">" $2;next}
1' FS='\t' ref.txt FS='>' seq.fa
The first statement is filling the array a with the content of the tab delimited file ref.txt.
The second statement prints all lines of the second files seq.fa with 2 fields given the > as field delimiter.
The last statement prints all lines of that same file.
I have about 100 comma-separated text files with eight columns.
Example of two file names:
sample1_sorted_count_clean.csv
sample2_sorted_count_clean.csv
Example of file content:
Domain,Phylum,Class,Order,Family,Genus,Species,Count
Bacteria,Proteobacteria,Alphaproteobacteria,Sphingomonadales,Sphingomonadaceae,Zymomonas,Zymomonas mobilis,0.0
Bacteria,Bacteroidetes,Flavobacteria,Flavobacteriales,Flavobacteriaceae,Zunongwangia,Zunongwangia profunda,0.0
For each file, I would like to replace the column header "Count" by sample ID, which is contained in the first part of the file name (sample1, sample2)
In the end, the header should then look like this:
Domain,Phylum,Class,Order,Family,Genus,Species,sample1
If I use my code, the header looks like this:
Domain,Phylum,Class,Order,Family,Genus,Species,${f%_clean.csv}
for f in *_clean.csv; do echo ${f}; sed -e "1s/Domain,Phylum,Class,Order,Family,Genus,Species,RPMM/Domain,Phylum,Class,Order,Family,Genus,Species,${f%_clean.csv}/" ${f} > ${f%_clean.csv}_clean2.csv; done
I also tried:
for f in *_clean.csv; do gawk -F"," '{$NF=","FILENAME}1' ${f} > t && mv t ${f%_clean.csv}_clean2.csv; done
In this case, "count" is replaced by the entire file name, but each row of the column contains file name now. The count values are no longer present. This is not what I want.
Do you have any ideas on what else I may try?
Thank you very much in advance!
Anna
If you are ok with awk, could you please try following.
awk 'BEGIN{FS=OFS=","} FNR==1{var=FILENAME;sub(/_.*/,"",var);$NF=var} 1' *.csv
EDIT: Since OP is asking that after 2nd underscore everything should be removed in file's name then try following.
awk 'BEGIN{FS=OFS=","} FNR==1{split(FILENAME,array,"_");$NF=array[1]"_"array[2]} 1' *.csv
Explanation: Adding explanation for above code here.
awk ' ##Starting awk program from here.
BEGIN{ ##Starting BEGIN section of code from here, which will be executed before Input_file(s) are being read.
FS=OFS="," ##Setting FS and OFS as comma here for all files all lines.
} ##Closing BEGIN section here.
FNR==1{ ##Checking condition if FNR==1 which means very first line is being read for Input_file then do following.
split(FILENAME,array,"_") ##Using split of awk out of box function by splitting FILENAME(which contains file name in it) into an array named array with delimiter _ here.
$NF=array[1]"_"array[2] ##Setting last field value to array 1st element underscore and then array 2nd element value in it.
} ##Closing FNR==1 condition BLOCK here.
1 ##Mentioning 1 will print the rest of the lines for current Input_file.
' *.csv ##Passing all *.csv files to awk program here.
I have a text file file.txt with several columns (tab separated), and the first column can contain indexes such as 1, 2, and 3. I want to update the first column so that 1 becomes "one", 2 becomes "two", and 3 becomes "three". I created a bash file a.sh containing:
declare -A DICO=( [1]="one" [2]="two" [3]="three" )
awk '{ $1 = ${DICO[$1]}; print }'
But now when I run cat file.txt | ./a.sh I get:
awk: cmd. line:1: { $1 = ${DICO[$1]}; print }
awk: cmd. line:1: ^ syntax error
I'm not able to fix the syntax. Any ideas? Also there is maybe a better way to do this with bash, but I could not think of another simple approach.
For instance, if the input is a file containing:
2 xxx
2 yyy
1 zzz
3 000
4 bla
The expected output would be:
two xxx
two yyy
one zzz
three 000
UNKNOWN bla
EDIT: Since OP had now added samples so changed solution as per that now.
awk 'BEGIN{split("one,two,three",array,",")} {$1=$1 in array?array[$1]:"UNKONW"} 1' OFS="\t" Input_file
Explanation: Adding explanation for above code too now.
awk '
BEGIN{ ##Starting BEGIN block of awk code here.
split("one,two,three",array,",") ##Creating an array named array whose values are string one two three with delimiter as comma.
}
{
$1=$1 in array?array[$1]:"UNKOWN" ##Re-creating first column which will be if $1 comes in array then its value will be aray[$1] else it will be UNKOWN string.
}
1 ##Mentioning 1 here. awk works on method of condition then action, so making condition is TRUE here and not mentioning any action so by default print of current line will happen.
' Input_file ##mentioning Input_file name here.
Since you haven't shown samples so couldn't tested completely, could you please try following and let me know if this helps.
awk 'function check(value){gsub(value,array[value],$1)} BEGIN{split("one,two,three",array,",")} check(1) check(2) check(3); 1' Input_file
Adding a non-one liner form of solution too here.
awk '
function check(value){
gsub(value,array[value],$1)
}
BEGIN{
split("one,two,three",array,",")
}
check(1)
check(2)
check(3);
1' OFS="\t" Input_file
Tested code as follows too:
Let's say we have following Input_file:
cat Input_file
1213121312111122243434onetwothree wguwvrwvrwvbvrwvrvr
vkewjvrkmvr13232424
Then after running the code following will be the output:
onetwoonethreeonetwoonethreeonetwooneoneoneonetwotwotwo4three4three4onetwothree wguwvrwvrwvbvrwvrvr
vkewjvrkmvronethreetwothreetwo4two4
Given a dico file containing this:
$ cat dico
1 one
2 two
3 three
You could use this awk script:
awk 'NR==FNR{a[$1]=$2;next}($1 in a){$1=a[$1]}1' dico file.txt
This fills the array a with the content of the dico file and replaces the first element of the file.txt file if this one is part of the array.
I have a .txt file like this:
ENST00000000442 64073050 64074640 64073208 64074651 ESRRA
ENST00000000233 127228399 127228552 ARF5
ENST00000003100 91763679 91763844 CYP51A1
I want to get only the last 3 columns of each line.
as you see some times there are some empty lines between 2 lines which must be ignored. here is the output that I want to make:
64073208 64074651 ESRRA
127228399 127228552 ARF5
91763679 91763844 CYP51A1
awk '/a/ {print $1- "\t" $-2 "\t" $-3}' file.txt.
it does not return what I want. do you know how to correct the command?
Following awk may help you in same.
awk 'NF{print $(NF-2),$(NF-1),$NF}' OFS="\t" Input_file
Output will be as follows.
64073208 64074651 ESRRA
127228399 127228552 ARF5
91763679 91763844 CYP51A1
EDIT: Adding explanation of command too now.(NOTE this following command is for only explanation purposes one should run above command only to get the results)
awk 'NF ###Checking here condition NF(where NF is a out of the box variable for awk which tells number of fields in a line of a Input_file which is being read).
###So checking here if a line is NOT NULL or having number of fields value, if yes then do following.
{
print $(NF-2),$(NF-1),$NF###Printing values of $(NF-2) which means 3rd last field from current line then $(NF-1) 2nd last field from line and $NF means last field of current line.
}
' OFS="\t" Input_file ###Setting OFS(output field separator) as TAB here and mentioning the Input_file here.
You can use sed too
sed -E '/^$/d;s/.*\t(([^\t]*[\t|$]){2})/\1/' infile
With some piping:
$ cat file | tr -s '\n' | rev | cut -f 1-3 | rev
64073208 64074651 ESRRA
127228399 127228552 ARF5
91763679 91763844 CYP51A1
First, cat the file to tr to squeeze out repeted \ns to get rid of empty lines. Then reverse the lines, cut the first three fields and reverse again. You could replace the useless cat with the first rev.